BIOLOGICAL OVERVIEW

Developmental regulators and cell cycle regulators have to interface in order to ensure appropriate cell proliferation during organogenesis. An analysis of the roles of the pan-neural genes deadpan and asense defines critical roles for these genes in regulation of mitotic activities in the larval optic lobes. Loss of deadpan results in reduced cell proliferation, while ectopic deadpan expression causes over-proliferation. In contrast, loss of asense results in increased proliferation, while ectopic asense expression causes reduced proliferation. Consistent with these observations endogenous Deadpan is expressed in mitotic areas of the optic lobes, and endogenous Asense is expressed in cells that will become quiescent. Altered Deadpan or Asense expression results in altered expression of the cyclin dependent kinase inhibitor gene dacapo. Thus, regulation of mitotic activity during optic lobe development may, at least in part, involve deadpan and asense mediated regulation of the cyclin dependent kinase inhibitor gene dacapo (Wallace, 2000).

Optic lobes begin development during embryogenesis between stages 11 and 12 when a group of 30-40 epidermal cells delaminates and moves from the surface of each brain hemisphere. Once delaminated, these cells remain inactive until the embryo hatches as a first instar larva. This inactive state of the cells is partially mediated by the glycoprotein Anachronism, secreted by glia surrounding the developing optic lobe (Ebens, 1993). In the first instar larva the cells begin to divide, a process requiring the function of the trol gene. These first divisions appear to be synchronous and continue through the beginning of pupal development. A total of approximately 3,000 cells are produced in the mitotically active areas of the optic lobe. During second instar some of the cells of the developing lamina and medulla begin to differentiate into neurons and glia. This differentiation is accompanied by the innervation of the first and second optic lobes by photoreceptor axons. Their arrival and the release of Hedgehog protein in the developing optic lobes begins the differentiation of the lamina cells into neurons and glia. The outer proliferation center (OPC) represents one of the major areas of mitotic activity in the optic lobe. The OPC becomes a distinct structure at late second instar and the cells in the OPC and the inner proliferating center (IPC) continue to divide until all of the photoreceptor axons have innervated the optic lobe and initiated differentiation of the lamina precursors. The lamina furrow spreads outward in a semicircle and passes through the OPC where the cells for the developing lamina originate. As the lamina furrow advances outward, the cells in the passing furrow arrest in G1 phase (Wallace, 2000 and references therein).

The IPC, which is the second major area of mitotic activity in the optic lobe, forms in a crescent shape at a more interior position of the brain with respect to the OPC. The IPC represents a pool of cells that produces the cells for the medulla and the lobula. The IPC cells, however, do not divide and differentiate in as synchronous an order as the OPC (Wallace, 2000).

To determine the functional properties of Dpn during larval development the pUAST/Gal4 system was used to test the effects of ectopic dpn expression. The 71B Gal4 driver line was used in this analysis, since it drives the expression of pUAST constructs in most cells of the second and third instar larval optic lobes. In addition, this line also drives strong expression in the wing discs. Bromodeoxyuridine (BrdU) incorporation and histone H1 RNA expression were used as S phase specific markers to detect changes in mitotic activity (Wallace, 2000).

In the larval central nervous system, ectopic Dpn expression results in a striking increase in the size of the brain lobes as compared to wild-type brains. In brains with ectopic Dpn expression, an increase in the number of mitotically active cells is apparent across the entire surface of the enlarged brain. In addition, a breakdown of the mitotic domain pattern that is present in wild-type third instar optic lobes is also evident. The over-proliferation phenotype that is associated with ectopic Dpn expression is fully penetrant. It can range from >10 times to two- to four-fold the size of a normal wild-type brain lobe, and appears sensitive to the accumulation modifiers in the genome (Wallace, 2000).

HES proteins can have opposite functions from proteins of the AS-C in neural development. ase, a member of the AS-C, has been reported to be expressed in the developing third instar optic lobes and loss of ase function results in disturbances of the adult optic lobe. It was asked whether the AS-C protein Ase can modulate mitotic activity. To this end, the effects of ectopic ase expression on mitotic activity in the developing larval optic lobe were investigated. As with Dpn, ectopic expression of Ase results in strong expression in most cells of the second and third larval optic lobes. This expression results in breaks in the normally continuous pattern of S phase positive cells in the OPC suggesting that increase and/or ectopic expression of the Ase protein decreases mitotic activity in the optic lobe (Wallace, 2000).

It was asked whether mitotic activity is altered in third instar larval optic lobes of dpn¹ homozygous loss of function mutants. dpn¹ is an apparent null allele of the dpn gene. In the OPC of dpn¹ homozygous third instar larvae, sporadic breaks are evident in the normally continuous area of S phase positive cells. These breaks can vary in size and location in the OPC, but can be found in the OPC of nearly all homozygous dpn¹ mutant larvae. In addition, S phase activity in the developing lamina appears compressed and disorganized (Wallace, 2000).

To better determine whether reduction in the amount of OPC neuroblasts in dpn¹ mutants results in a significant loss of OPC neuroblast progenies, assays were performed for developing lamina cells that represent direct progeny of the OPC cells. If there is a reduction in the amount of cells in the OPC, a subsequent reduction in the amount of developing lamina cells could be expected. Anti-Dachshund antibodies were used to mark the cells of the developing lamina. In dpn¹ homozygous mutant third instar larvae, a reduced number of Dachshund (Dac) positive cells is evident as compared to the wild type. Photoreceptor axons that innervate the lamina are responsible for initiating the differentiation of the cells into neurons and glia. It was necessary to determine whether the reduced number of cells is due to an aberrant projection of photoreceptor axons. Anti-HRP antibodies were used to mark the photoreceptor axons in dpn¹ homozygous larvae. Overall size and morphology of the eye disc, as well as photoreceptor axon extension and innervation of the lamina in dpn¹ larvae appears normal. One difference, however, is that the area of innervation is smaller than wild type. The reduced number of developing lamina cells in dpn¹ loss of function larvae indeed may, therefore, be due to a reduced amount of OPC neuroblasts rather than aberrant axon projection (Wallace, 2000).

To analyze the possible involvement of ase gene function on mitotic activity in the larval optic lobes, the S phase activity in third instar larval brains was determined. In ase¹/sc^b57 mutants, there is an expansion of S phase activity to include the normally mitotic quiescent cells between the OPC and the lamina precursor cells (LPCs), as well as scattered S phase activity in the lamina. ase¹ is a deletion of the ase coding region and sc^B57 is a deletion of the entire AS-C as well as the proximal complementation group EC4 making the larva homozygous mutant for ase and heterozygous for the other members of the AS-C. In contrast, +/sc^B57 larval optic lobes show normal S phase activity. Thus, ase loss of function mutants show an increase in the S phase activity between the OPCs and the LPCs, and a random pattern of increased S phase activity in the lamina (Wallace, 2000).

If Dpn is involved in the positive regulation of mitotic activity, as indicated by the dpn loss of function and ectopic expression phenotypes, then Dpn would be expected to be expressed in mitotic active areas. Endogenous dpn protein expression was examined in the wild-type larval CNS; Dpn was found to be expressed in areas of active cell division in the optic lobes. Dpn is expressed in the OPC of the late third instar larva and stops at the edge of the OPC. After cells exit the OPC, S phase activity ceases and the cells subsequently arrest in G1 as they pass through the lamina furrow. Dpn is also expressed in the cells of the IPC. Thus, expression of Dpn in the larval optic lobes is in agreement with a possible role as one positive regulator of the cell cycle (Wallace, 2000).

If Ase is involved in the termination of mitotic activity in the larval optic lobes, then Ase expression would be expected in or near areas where the cell cycle is arresting. Ase protein expression was examined in the larval optic lobes; Ase was found to be present in a band at the posterior edge of the OPC that partially overlaps with Dpn expression. Ase is expressed just before the cells exit the OPC and cease S phase activity. These cells then arrest in G1 phase as they pass through the lamina furrow. Ase is also expressed in cells of the IPC and at a low level in the lamina furrow. The expression pattern of Ase, which comes to a maximum at the posterior edge of the OPC, is in agreement with a possible role for Ase in aiding cell cycle arrest as cells leave the OPC (Wallace, 2000).

Cdk inhibitors have been shown to represent key regulators of mitotic activity. In Drosophila a cdk inhibitor gene, dap, has been identified that is transiently expressed during embryogenesis in cells prior to entering their last mitosis and at the onset of terminal differentiation. Ectopic expression of dap results in G1 arrest, while loss of dap function has been shown to cause one extra cell division in embryonic epidermal cells. Dpn appears to promote the continuation of mitotic activity, while Ase has a role in ending cell proliferation in the developing optic lobes. Therefore, it was asked whether altered expression of Dpn and Ase can modulate the expression of the dap. In wild-type third instar larva, optic lobe expression of dap occurs in specific domains. dap is expressed in cells of the lamina furrow and scattered cells of the lamina. There is also strong expression of dap in a subset of cells in the IPC throughout third instar. In contrast, dap expression is virtually absent from the cells of the OPC (Wallace, 2000).

The effects were determined of the loss of dpn function on the expression of dap. In homozygous dpn¹ mutant third instar larva, expression expands into the area of the OPC. Also, cells of the lamina begin to express dap more strongly. In contrast, in larvae with ectopic Dpn expression, dap expression is strongly reduced or absent in the optic lobes of third instar larva. Thus, dpn activity has a negative regulatory effect on the dap RNA level (Wallace, 2000).

In homozygous ase mutant third instar larvae, there is a strong reduction of dap RNA throughout the entire developing optic lobe while dap expression in the developing eye disk appears normal. The ase loss of function phenotype demonstrates that ase activity is necessary for the expression of dap throughout the developing optic lobe. When Ase is ectopically expressed in third instar optic lobes, ectopic activation of dap expression becomes evident. Therefore, ase activity has a positive regulatory effect on the dap RNA level (Wallace, 2000).

It was asked whether the phenotypical effects on cell proliferation produced by alterations of Dpn and Ase expression may be caused, at least in part, by changes in the levels of dap transcript. During embryogenesis, alteration in the levels of dap expression through either ectopic expression or by loss of function, result in dramatic changes in mitotic activity. Therefore, the mitotic activity in optic lobes of homozygous dap⁶ mutant third instar larvae were analyzed. While predominately recessive lethal, a few dap⁶ homozygous escapees can be viable to adulthood. Therefore, the larval optic lobes of homozygous dap⁶ mutant third instar larva can be analyzed. In such homozygous dap⁶ mutant larvae over-proliferation of the cells of the optic lobes is evident. There is a significant increase in the number of mitotically active cells and break down of mitotic domains, as compared to the wild type (Wallace, 2000).

The over-proliferation phenotype of dap⁶ null mutants can be compared to the over-proliferation phenotype in larvae with ectopic dpn expression, and the associated suppression of dap expression. Although the over-proliferation in both cases is similar, there are clearly more cells produced in the dpn over-expressing brain lobes. This strongly indicates that other cell cycle regulators are also likely to be affected by the ectopic expression of dpn in the optic lobes (Wallace, 2000).

A model is proposed for mitotic control in the developing third instar optic lobe in which cell proliferation is modulated by a positive regulator of mitotic activity such as Dpn and a negative regulator of mitotic activity such as Ase. In this model, one role of Dpn and Ase would be to interface with cell cycle regulation through the direct or indirect modulation of dap expression. Mitotic control during optic lobe development may involve the following events. Cells that give rise to the optic lobe delaminate from the neuroectoderm during embryogenesis and remain quiescent until first instar with the help of proteins such as Anachronism. The mitotic activity is then initiated through a process that requires the trol gene product and the developmental regulator and transcription factor Eve to begin the proliferation of neuroblasts to form the OPC. The mitotically active state of OPC cells would be maintained in part by Dpn. In the absence of Dpn, the cells in the OPC have a greater chance of exiting mitosis by allowing Dap to be expressed. As cells arrive at the edge of the OPC, Ase is expressed at high levels, allowing the neuroblasts to become quiescent only after they pass out of the region where Dpn is expressed. Suppression of dap by Dpn in the OPC would allow the neuroblasts to be mitotically active while the increased expression of Ase at the posterior edge of the OPC allows the neuroblasts to exit mitosis and begin differentiation. In addition, the resulting quiescent state needs to be maintained in the lamina; otherwise the cells may reenter mitosis (Wallace, 2000 and references therein).

The bHLH repressor Deadpan regulates the self-renewal and specification of Drosophila larval neural stem cells independently of Notch

Neural stem cells (NSCs) are able to self-renew while giving rise to neurons and glia that comprise a functional nervous system. However, how NSC self-renewal is maintained is not well understood. Using Drosophila larval neuroblasts as a model, this study demonstrates that the Hairy and Enhancer-of-Split (Hes) family protein Deadpan (Dpn) plays important roles in NB self-renewal and specification. The loss of Dpn leads to the premature loss of NBs and truncated NB lineages, a process likely mediated by the homeobox protein Prospero (Pros). Conversely, ectopic/over-expression of Dpn promotes ectopic self-renewing divisions and maintains NB self-renewal into adulthood. In type II NBs, which generate transit amplifying intermediate neural progenitors (INPs) like mammalian NSCs, the loss of Dpn results in ectopic expression of type I NB markers Asense (Ase) and Pros before these type II NBs are lost at early larval stages. These results also show that knockdown of Notch leads to ectopic Ase expression in type II NBs and the premature loss of type II NBs. Significantly, dpn expression is unchanged in these transformed NBs. Furthermore, the loss of Dpn does not inhibit the over-proliferation of type II NBs and immature INPs caused by over-expression of activated Notch. These data suggest that Dpn plays important roles in maintaining NB self-renewal and specification of type II NBs in larval brains and that Dpn and Notch function independently in regulating type II NB proliferation and specification (Zhu, 2012).

Dpn was initially identified as a pan-neural protein and has been widely used as a NB marker. However, the function of Dpn in NBs has been elusive. This study provides evidence that Dpn plays an important role in maintaining NB self-renewal. In type II NBs, in addition to maintaining the self-renewal, Dpn is also required to suppress Ase expression when these NB exit quiescence. Furthermore, Notch and Dpn may function independently in larval NBs. While both Dpn and Notch are required for maintaining the identity and self-renewal of type II NBs, knockdown of Notch does not affect the expression of Dpn in type II NBs (Zhu, 2012).

In a developing nervous system, NSCs must be maintained when they divide in order to generate the complete array of neurons and glia that form a functional neuronal circuit. Current studies are focused on determining how NSC self-renewal is maintained, as well as mechanisms governing NSC terminal differentiation. The findings that dpn mutant MB NBs as well as other type I NBs are prematurely, progressively, lost demonstrate that Dpn functions cell-autonomously to maintain the self-renewal of larval NBs. Interestingly, in dpn mutant larvae, the premature loss of type I NBs mainly occurred within 48 hours after larval hatching (with the exception of the MB NB). Zacharioudaki (2012) has reported recently that Dpn and E(spl) proteins function redundantly to maintain NB self-renewal but have different temporal expression patterns. Dpn expression in NBs is activated at the newly hatched larval stage, whereas E(spl)mγ expression becomes obvious only when NBs start to divide at the 2^nd instar larval stage. The difference in temporal expression patterns between Dpn and E(spl) proteins probably explains why loss of type I NBs occurred mainly within 48 hours after larval hatching in dpn mutants. Interestingly, despite the redundant function of Dpn and E(spl) proteins in maintaining NB self-renewal, loss of Dpn alone resulted in the premature loss of MB NBs at late larval/early pupal stages, indicating that E(spl) proteins may not be involved in maintaining MB NBs at late larval/early pupal stages. The current findings as well as those of Zachariousdaki suggest that Dpn is required for maintaining NB self-renewal rather than NB formation or specification as was proposed by San-Juan and Baonza (2011). It is likely that differences in identifying and quantifying NBs at different developmental stages accounts for this discrepancy (Zhu, 2012).

The role of Dpn in NB self-renewal is also supported by the observation that ectopic/over-expression of Dpn promoted non-dividing immature intermediate INPs and terminally dividing GMCs to enter self-renewing divisions, and prolonged the self-renewal of both types of NBs. These ectopic self-renewing GMCs and immature INPs, which normally do not express Dpn, may de-differentiate to acquire a NB-like fate and contribute to the increased number of NBs, similar to what has been observed in brat, numband klumpfuss mutant type II NB lineages. However, type II NB lineages show more severe over-proliferation phenotypes than type I NB lineages in response to ectopic/over-expression of Dpn. The difference in degree of over-proliferation between the type I and type II NB lineages is likely related to intrinsic differences between the type I and type II NB daughters, rather than a difference in how Dpn itself is acting. Type I NBs produce GMCs that express genes such as pros and ase that limit proliferation, counteracting the pro-self-renewal function of Dpn. In contrast, type II NBs and immature INPs express the ETS family protein Pointed but do not express Ase or Pros, making them particularly susceptible to the ectopic expression of genes, such as dpn, that promote self-renewal. It is proposed that the significantly enhanced proliferation of type II NB progeny in response to ectopic/increased Dpn expression is most likely due to a disparity in the inherent self-renewal potential of the type I and type II NB daughters (Zhu, 2012).

The function of Dpn in maintaining NB self-renewal is consistent with mammalian Hes family proteins' function in maintaining NSCs. In the developing mammalian nervous system, the loss of Hes1, Hes3, and Hes5 leads to accelerated neurogenesis and premature depletion of neuroepithelial cells and radial glial cells, whereas forced expression of Hes proteins maintains NSCs (Zhu, 2012).

While Dpn is expressed in both type I and type II NBs, the data showed that the loss of Dpn not only resulted in the premature loss of type II NBs at early larval stages, but also led to the ectopic expression of type I NB markers Ase and Pros in type II NBs when they exited quiescence, making type II NBs appear as type I-like NBs. This indicates Dpn has two roles in type II NBs: Dpn maintains NB self-renewal just as it does in type I NBs, and Dpn is also required to maintain type II NB identity. Moreover, it appears that Dpn's role in maintaining type II NB identity is temporally restricted. Results from this study as well as others showed that dpn mutant embryonic brains contained a comparable number of Dpn⁺ Ase^- NBs as wild type embryonic brains. In dpn mutant clones, the results showed that type II NBs did not ectopically express Ase even 4 days after clone induction when Dpn is no longer detectable. Therefore, it seems that Dpn's function to suppress Ase expression is limited to a narrow temporal window during the reactivation of type II NBs at the 1^st instar larval stage. How might Dpn act to maintain type II NB identity? In mammals, Hes family proteins are well known for their roles in antagonizing the expression and/or activity of proneural genes (Ase is a member of the achaete-scute family of proneural genes). Negative interactions between dpn and the achaete-scute complex (AS-C) genes occur during Drosophila sex determination as well as neurogenesis. One potential model could be that a proneural protein(s) might be expressed in quiescent type II NBs and that Dpn is required to antagonize its expression and/or activity in order to promote type II NB fate when NBs exit quiescence. Since Dpn is expressed in both type I and type II NBs, it is postulated that its role in maintaining type II NB fate is associated with the differential expression and/or activity of another, currently unidentified gene (Zhu, 2012).

This work suggests that the premature loss of dpn mutant type I NBs could be mediated by Pros. This is supported by the findings that nuclear Pros precociously accumulates in dpn mutant type I NBs and that dpn mutant type I NBs are maintained even in adult brains in the absence of Pros. It has been shown that over-expressing Pros in embryonic and larval NBs is sufficient to induce ectopic nuclear Pros localization and terminal division. Therefore, one possibility is that Dpn negatively regulates pros expression. In the absence of Dpn, Pros expression increases, leading to the nuclear accumulation of Pros and thus premature terminal division. In type I NBs, dynamic cortical and cytoplasmic localization of Pros makes it difficult to compare the levels of Pros in wild type and dpn mutant type I NBs by immunostaining. However, ectopic Pros expression in dpn mutant type II NBs, which normally do not have Pros, provide evidence that Dpn negatively regulates Pros expression, either directly or indirectly. The existence of putative Dpn binding sites in the pros promoter suggests that Dpn could directly regulate pros expression. Alternatively, Dpn could indirectly regulate pros by inhibiting the expression and/or activity of proteins, such as Ase, that promote pros expression. In support of this notion, it has been shown that mammalian Hes proteins can inhibit the expression of proneural proteins such as Mash1 in the developing cortex, whereas forced expression of the proneural protein Mash1 in neuroepithelial cells is sufficient to promote the expression of Prox1, the mammalian homolog of Pros that plays an anti-proliferative and pro-differentiation role in the developing mammalian hippocampus and retina (Zhu, 2012).

Unlike the majority of mammalian Hes proteins or other members of the fly Hes family, which typically act downstream of Notch, results from this study as well as Zacharioudaki (2012) do not support a model in which Dpn functions as a direct target of Notch signaling in larval NBs as was proposed by San Juan and Baonza (2011). First, although these studies, as well as the work from other investigators, showed that the knockdown of Notch or disruption of Notch signaling led to premature loss of type II NBs and ectopic expression of Ase in type II NBs as was observed in dpn mutant larval brains, knockdown of Notch did not affect the expression of Dpn in type II NBs, which is consistent with previous findings. Second, the data and those of Zacharioudaki showed that removing Dpn did not abolish the over-proliferation of type II or type I NBs caused by over-expression of activated Notch. Nor did reducing Notch expression exacerbate the loss of type II NBs in dpn⁷ heterozygous animals. These genetic interaction data suggest that Dpn does not function downstream of Notch signaling. Thus, Dpn may be similar to the mammalian Hes2 and Hes3, which are not transcriptionally regulated by Notch.Notch and Dpn likely employ distinct mechanisms to maintain the self-renewal and suppress Ase expression in type II NBs. Zacharioudaki showed that some E(Spl) proteins, particularly E(spl)mγ and m8, depend on Notch signaling for their expression in larval NBs. However, loss of E(Spl) proteins does not result in ectopic expression of Ase in type II NBs. Therefore, Notch must function through molecules, which are yet to be identified, to regulate Ase expression in type II NBs (Zhu, 2012).

bHLH-O proteins balance the self-renewal and differentiation of Drosophila neural stem cells by regulating Earmuff expression

Balancing self-renewal and differentiation of stem cells requires differential expression of self-renewing factors in two daughter cells generated from the asymmetric division of the stem cells. In Drosophila type II neural stem cell (or neuroblast, NB) lineages, the expression of the basic helix-loop-helix-Orange (bHLH-O) family proteins, including Deadpan (Dpn) and E(spl) proteins, is required for maintaining the self-renewal and identity of type II NBs, whereas the absence of these self-renewing factors is essential for the differentiation of intermediate neural progenitors (INPs) generated from type II NBs. This study demonstrates that Dpn maintains type II NBs by suppressing the expression of Earmuff (Erm). Evidence is provided that Dpn and E(spl) proteins suppress Erm by directly binding to C-sites and N-boxes in the cis-regulatory region of erm. Conversely, the absence of bHLH-O proteins in INPs allows activation of erm and Erm-mediated maturation of INPs. The results further suggest that Pointed P1 (PntP1) mediates the dedifferentiation of INPs resulting from the loss of Erm or overexpression of Dpn or E(spl) proteins. Taken together, these findings reveal mechanisms underlying the regulation of the maintenance of type II NBs and differentiation of INPs through the differential expression of bHLH-O family proteins (Li, 2017).

This study demonstrates that similar to the canonical Notch signaling, Dpn maintains the identity and self-renewal of type II NBs at least in part by inhibiting Erm expression. Loss of Dpn leads to the ectopic activation of erm in type II NBs and that removing Erm not only prevents the transformation of dpn mutant or Dpn knockdown type II NBs into type I-like NBs but also largely inhibits their premature termination of self-renewal. The results from gel-shift assays and reporter assays provide evidence to support that Dpn and E(spl) proteins suppress Erm expression by directly binding to at least two of the three putative bHLH-O binding sites in the erm enhancer (Li, 2017).

Although Dpn and canonical Notch signaling could function through a similar mechanism, these factors do not appear to be completely functionally redundant as previously suggested. First, during early 1st instar larval stages when type II NBs are still quiescent, the maintenance of type II NBs may mainly rely on Dpn in that Notch is not activated in quiescent type II NBs, as evidenced through the findings showing that the loss of Dpn at early 1st instar larval stages leads to ectopic Erm-mediated transformation and the premature loss of type II NBs. Second, after reactivation of type II NBs, both Dpn and Notch signaling are required to suppress the ectopic Erm expression in type II NBs because both the loss of Dpn and the components of the canonical Notch signaling pathways alone lead to ectopic Erm expression in type II NBs. However, the Notch signaling likely plays a dominant role in suppressing ectopic Erm expression and maintaining type II NBs. It has been previously shown that the loss of components of the canonical Notch pathway, including E(spl) proteins, leads to ectopic Erm expression and the transformation and premature loss of type II NBs, despite the presence of Dpn in the NBs, whereas the knockdown of Dpn after the reactivation of NBs only results in the weak ectopic activation of erm but not transformation or premature loss of type II NBs. Therefore, Dpn and Notch signaling may not be completely functionally redundant in suppressing the ectopic Erm expression or maintaining type II NBs, and their functions might be dependent on developmental stages. Furthermore, a recent study reported that Klu could also bind to the R9D11 enhancer to repress the expression of Erm. Thus, type II NBs likely utilize multiple mechanisms to ensure that erm will not be prematurely activated (Li, 2017).

Previous studies suggested that all E(spl) proteins share similar DNA sequences. However, results from the present study suggest that this similarity may not always be the case. Gel-shift assays show that only members of the E(spl) family, including E(spl)mγ, mβ, mδ, m3, and m7, can bind to the bHLH-O binding sites in the erm regulatory region, whereas the other two, E(spl)m5 and m8, cannot. The difference in their DNA binding specificity is consistent with differences in the amino acid sequences of their bHLH domains and their overexpression phenotypes in type II NB lineages. Therefore, although multiple E(spl) proteins have been shown to be expressed in larval NBs and at least two of them, E(spl)mγ and m8, are activated by Notch, these E(spl) proteins may bind to different DNA sequences and regulate the expression of different target genes, which may in turn determine their functional specificity (Li, 2017).

In contrast to the maintenance of type II NBs, the maturation of imINPs requires the activation of erm by PntP1 and shutdown of Dpn expression and Notch signaling. It has previously been shown that the loss of Erm or aberrant activation of dpn or Notch signaling in imINPs both lead to the dedifferentiation of imINPs and overproliferation of type II NBs. However, the functional relationship between the activation of erm and the absence of Dpn or Notch signaling in imINPs has never been established. This study demonstrates that the absence of Dpn and Notch signaling is essential for the activation of erm and subsequent Erm-mediated maturation of INPs. First, the results show that aberrant activation of dpn or Notch signaling inhibits the activation of erm in imINPs. Second, maintaining Erm expression in imINPs largely blocks the overproliferation of type II NBs resulting from the misexpression of E(spl) or Dpn proteins, suggesting that one main reason for the dedifferentiation of imINPs caused by Dpn or E(spl) overexpression is the suppression of Erm. However, the overproliferation of type II NBs resulting from the overexpression of Nintra or Numb knockdown can only be partially suppressed by concomitant Erm expression. Therefore, in addition to functioning through the canonical pathway to activate E(spl) expression, Notch may also act through noncanonical pathways, such as the mTORC2/Akt pathway, to regulate type II NB proliferation (Li, 2017).

How does Erm promotes INP maturation and prevents the dedifferentiation of imINP? It has previously been suggested that Erm prevents the dedifferentiation of INPs by activating pros expression and attenuating the response of INPs to self-renewing factors such as Dpn and E(spl) proteins. However, two pieces of evidence argue against this notion. First, the loss of Pros only induces the overproliferation of INPs but not the dedifferentiation of imINPs into type II NBs . Second, Erm is only expressed in imINPs, which do not express Dpn or E(spl) proteins. In the present study, evidence is provided demonstrating that Erm likely promotes INP maturation in part by inhibiting the expression and/or function of PntP1. These results show that the overproliferation of type II NBs resulting from the loss of Erm or overexpression of Dpn or E(spl) proteins, which leads to suppression of Erm expression, could be significantly inhibited by knocking down PntP1. These data strongly argue that the dedifferentiation of imINPs and generation of extra type II NBs resulting from the loss of Erm is in part due to de-repression of PntP1 expression and/or function in imINPs, which is consistent with the PntP1 function in specifying type II NBs and suppressing the activation of ase. Similar to other Ets family proteins that are commonly involved in tumorigenesis, PntP1 may also activate the expression of cell cycle regulators that promote nonproliferative imINPs to enter the cell cycle and initiate unrestricted tumorigenic overproliferation. However, PntP1 may not be the only target of Erm in imINPs. As shown in a recent study, in addition to PntP1, Erm also directly inhibits the expression of Grh-O in imINPs (Janssens, 2017). Therefore, Erm likely promotes the maturation of INPs by regulating the expression/function of multiple target genes (Li, 2017).

In conclusion, this study demonstrates here that similar to Notch signaling, Dpn maintains the identity and self-renewal of type II NBs in part by inhibiting Erm expression. Whereas in imINPs, the absence of Dpn and E(spl) proteins allows PntP1-mediated activation of erm, which in turn promotes INP maturation by inhibiting the expression and/or function of PntP1 and Grh-O in imINPs. Thus, the present study elucidates the mechanistic details of the maintenance of type II NBs and maturation of INPs (Li, 2017).

A switch in tissue stem cell identity causes neuroendocrine tumors in Drosophila gut

Intestinal stem cells (ISCs) are able to generate gut-specific enterocytes, as well as neural-like enteroendocrine cells. It is unclear how the tissue identity of the ISC lineage is regulated to confer cell-lineage fidelity. This study shows that, in adult Drosophila midgut, loss of the transcriptional repressor Tramtrack in ISCs causes a self-renewal program switch to neural stem cell (NSC)-like, and that switch drives neuroendocrine tumor development. In Tramtrack-depleted ISCs, the ectopically expressed Deadpan acts as a major self-renewal factor for cell propagation, and Sequoia acts as a differentiation factor for the neuroendocrine phenotype. In addition, the expression of Sequoia renders NSC-specific self-renewal genes responsive to Notch in ISCs, thus inverting the differentiation-promoting function of Notch into a self-renewal role as in normal NSCs. These results suggest an active maintenance mechanism for the gut identity of ISCs, whose disruption may lead to an improper acquisition of NSC-like traits and tumorigenesis (Li, 2020).

In addition to the nervous system, neuroendocrine (NE) cells are found in many non-neural tissues and can develop neoplasias that are known as NE tumors (NETs). The NE cells in non-neural tissues display characteristics that are typical of neurons, such as membrane excitability and hormone secretion, yet many of these NEs are generated from adult stem cells of endodermal origin. It is, thus, intriguing how the tissue identity of stem cells is regulated and controlled to safeguard cell-lineage fidelity (Li, 2020).

The intestinal epithelium in adult Drosophila midgut is maintained by intestinal stem cells (ISCs)-the multipotent cells that are capable of generating both absorptive enterocytes (ECs) and secretary enteroendocrine cells (EEs). EEs are neural-like cells and are able to secrete sets of hormone peptides that are similar to those secreted by NE cells in the Drosophila brain. While the initiation of EC generation is driven by Delta (Dl)/Notch-mediated lateral inhibition between the two immediate stem cell daughters, the initiation of EE generation occurs at the stem cell level, with a transient expression of the proneural gene Scute (Sc) that induces ISCs to self-renew and to generate an EE progenitor cell (EEP). Each EEP then divides one more time before terminal differentiation to yield a pair of EEs. Sc encodes a basic helix-loop-helix (bHLH) transcription factor and belongs to the achaete-scute gene complex (AS-C), a Drosophila proneural gene cluster that is expressed in neural progenitor cells and is important for the development of the embryonic central nervous system and sensory organs of both larva and adult. Thus, it appears that there is a transient activation of neural-like programs in ISCs that directs EE generation from ISCs (Li, 2020).

Tramtrack (Ttk, or Ttk69 isoform), which encodes a BTB-domain-containing transcriptional repressor, acts as a master repressor of the differentiation of EEs from ISCs. Depletion of ttk in ISCs causes derepression of AS-C genes including Sc and Asense (Ase). The continuous expression of Sc and Ase directs ISCs to continuously generate EEs, leading to the formation of EE-like tumors, or NETs. One intriguing observation from the ttk-depleted ISCs is that continuous derepression of the differentiation-promoting factors does not compromise ISC maintenance, but continuous overexpression of Sc in normal ISCs will cause regional ISC loss over time. This study characterized the ttk-depleted ISCs and, surprisingly, found that the original self-renewal program of ISCs had switched to a neuroblast-like self-renewal program that is responsible for NET tumorigenesis (Li, 2020).

The results reveal an ISC-to-NB switch in the tissue stem cell self-renewal program that drives NET development from ttk- depleted ISCs. Loss of ttk causes the derepression of NB-specific transcription factors, including dpn and seq, and the concomitant loss of ISC-specific factors. The ectopically expressed Dpn acts as a major self-renewal factor for the self-duplication of tumor cells, while Seq has a 'selector' function in selecting Notch target genes by recruiting Su(H) to the enhancer regions of NB-specific genes, thereby rendering these genes responsive to Notch in the tumor cells. In addition, Seq also has a role in NE differentiation by inducing AS-C gene expression. The cooperative function of Dpn and Seq leads to the activation of a NB-like self-renewal program as well as a NE differentiation program and the continuous activation of these two programs leading to NET development from ISCs (Li, 2020).

There are two types of NBs in the central brain of Drosophila larva: type I and type II. Dpn is specifically expressed in the type II but not the type I NBs. Interestingly, Notch appears to be more important in type II NBs than in type I NBs. Thus, it appears that the ectopically activated self-renewal program in ISCs described in this study is more similar to that used in the type II NBs. Compared to the type I NB lineage, the type II NB lineage goes through one extra type of transient amplification progenitors before terminal cell fate specification, indicating that this type II-like self-renewal program, if hijacked by tumor cells, could potentially be more potent to initiate tumorigenesis (Li, 2020).

As the loss of a single factor, Ttk, in ISCs is sufficient for the switch of tissue stem cell program and for the subsequent development of NETs in the midgut, Ttk could be viewed as a specific class of stem cell factors, which is proposed in this study as a tissue identity maintenance (TIM) factor; such factors function to safeguard the tissue identity of stem cells. ISCs not only give rise to ECs that function to digest and absorb nutrients but also give rise to neural-like EE cells. Conceivably, ISCs may need to use a basal or transient neural-like program in order to endow their capacity to generate EEs, as the proneural factor Sc is transiently expressed in ISCs, and this transient expression initiates EE generation. In this context, a stem cell identity factor like Ttk may be necessary to enable ISCs to maintain a gut identity and thereby prevent excessive acquisition of NSC-like traits (Li, 2020).

The Ttk protein is characterized by having a BTB domain in addition to a zinc-finger DNA-binding domain, and although there is no direct protein ortholog of Ttk in mammals, BTB-domain-containing transcription factors are found in all eukaryotes, including mammals. Moreover, alteration of Notch activity as well as increased expression of proneural genes are also known to occur in mammalian models of NETs and in human NETs. Thus, it is possible that there are TIM factors that function in stem cells in other tissues and organisms and that 'stem cell identity switch' could be a common mechanism underlying NET formation and, possibly, other stem-cell-mediated tumorigenesis (Li, 2020).

cDNA clone length - 2.2 kb

Base pairs in 5' UTR -269

Base pairs in 3' UTR - 448

PROTEIN STRUCTURE

Amino Acids - 432

Structural Domains and Evolutionary Homologies

Deadpan has a basic HLH domain, and a C-terminal WRPW domain found also in Hairy and Enhancer of split (Bier, 1992).

Promoter Structure

One of the fundamental questions in developmental biology is the role of gene activity in determining tissue fate, and how these activities are carried out both temporally and spatially. An approach to this question employs promoter analysis, the dissection of promoter sequences to find out what elements are responsible for the various genetically controlled tissue expression patterns. For deadpan, central nervous system and peripheral nervous system expression are determined by separate promoter elements. A proximal element is responsible for CNS expression, and within that element, separate regions control neuroblast (neural stem cell) versus neuronal expression. A second upstream element controls PNS expression, by specific repression of CNS expression. Thus deadpan integrates specific information from a variety of spatially and/or temporally restricted upstream regulators (Emery, 1995).

Other pan-neural genes are not required to initiate a pathway, but are needed to regulate the final outcome. Two examples are scratch and elav. These have simpler promoters, able to respond to only a small number of pan-neurally expressed transcription factors. This is reminiscent of a similar situation found in the regulation of primary versus secondary pair-rule genes (Emery, 1995).

bHLH-O proteins are crucial for Drosophila neuroblast self-renewal and mediate Notch-induced overproliferation

Drosophila larval neurogenesis is an excellent system for studying the balance between self-renewal and differentiation of a somatic stem cell (neuroblast). Neuroblasts (NBs) give rise to differentiated neurons and glia via intermediate precursors called GMCs or INPs. E(spl)mγ, E(spl)mβ, E(spl)m8 and Deadpan (Dpn), members of the basic helix-loop-helix-Orange protein family, are expressed in NBs but not in differentiated cells. Double mutation for the E(spl) complex and dpn severely affects the ability of NBs to self-renew, causing premature termination of proliferation. Single mutations produce only minor defects, which points to functional redundancy between E(spl) proteins and Dpn. Expression of E(spl)mγ and m8, but not of dpn, depends on Notch signalling from the GMC/INP daughter to the NB. When Notch is abnormally activated in NB progeny cells, overproliferation defects are seen. This depends on the abnormal induction of E(spl) genes. In fact E(spl) overexpression can partly mimic Notch-induced overproliferation. Therefore, E(spl) and Dpn act together to maintain the NB in a self-renewing state, a process in which they are assisted by Notch, which sustains expression of the E(spl) subset (Zacharioudaki, 2012).

This paper presents an analysis of the expression and function of two types of bHLH-O proteins expressed in Drosophila neuroblasts, Dpn and the E(spl) family. The main conclusions are that (1) these two types of factors have distinct expression modalities: E(spl)mγ and m8 are targets of Notch signalling, whereas Dpn is not; (2) these factors have redundant functions to maintain NBs in a self-renewing state in normal development, yet (3) in a pathological NB hyperproliferation context, Dpn and E(spl) have distinct functions (Zacharioudaki, 2012).

It was heretofore thought that embryonic NBs are cells that escape from Notch signalling, which is only perceived in the surrounding neuroectoderm. Only in the later post-embryonic period, were the NBs thought to respond to Notch. This study has shown that this happens much earlier, already in the embryonic NBs. Soon after the NB delaminates, a time when it sends, but does not receive, a Notch signal, it starts asymmetrically dividing. The results are consistent with the daughter GMCs sending a Delta signal back to their sister NBs, thereby initiating E(spl) expression. E(spl)mγ expression ceases when the NB enters quiescence, only to restart when proliferation resumes (Zacharioudaki, 2012).

Dpn, another bHLH-O protein, is also expressed in NBs, but much less dynamically. Its expression initiates upon NB delamination from the neuroepithelium and persists throughout its life. dpn does display some degree of dynamic expression, as it is rapidly turned off in the immature intermediate progenitors (iINPs), only to be reactivated upon maturation. Loss-of-function data clearly indicate that it is not a target of Notch in the NB, in contrast to E(spl). Paradoxically, dpn is induced upon Notch hyperactivation. This could be an indirect effect mediated through E(spl). Indeed, E(spl)mγ overexpression can induce ectopic dpn expression. Still, dpn does harbour a Notch-responsive enhancer that drives expression in larval NBs. This same region scored positively for Su(H) binding in a ChIP-chip approach in a cell line of mesodermal origin . How this enhancer contributes to the overall expression pattern of dpn will be a matter of future analysis (Zacharioudaki, 2012).

Despite their different expression modalities, Dpn and E(spl) have redundant functions in the larval NBs, as only double mutant clones show proliferation defects. These mutant NBs do not stop proliferating immediately, rather gradually terminate their cycling within a few days following homozygosing of the mutant alleles. It is proposed that Dpn/E(spl) keep the NB in an undifferentiated state and proliferation is a consequence of the ability of these cells to respond to mitogens. Upon Dpn/E(spl) loss, this state becomes unstable and prone to switch to a terminally differentiated state. This transition takes a few days, probably reflecting the time needed to accumulate pro-differentiation factors. A redundant role of Dpn/E(spl) in maintaining the undifferentiated state also during quiescence transpired from the genetic analysis of NB re-activation after embryogenesis. Whereas dpn^–/– NBs quite successfully re-entered the cell cycle, dpn^–/–;E(spl)^+/– NBs were unable to do so, despite trophic growth factor stimulation (Zacharioudaki, 2012).

E(spl) expression has been associated with the less differentiated of two alternative outcomes in other instances. For example, during NB formation, E(spl) genes are expressed in the undifferentiated embryonic neuroectoderm and not in the NBs. The same happens in the optic lobe neuroepithelium. This work has presented evidence for a similar role for Dpn/E(spl) in the NB. Excessive Dpn/E(spl) activity in GMCs/INPs can revert these partially differentiated cells back to a NB-like fate. For this reason, NB asymmetric divisions must ensure that Dpn and E(spl) are never expressed in the GMC or iINP. Regarding E(spl), it is proposed that this is ensured by the directionality of Notch signalling (GMC to NB). Dpn is also never seen to accumulate in the GMCs/iINPs, suggesting a repression mechanism at work in these cells, e.g., via Pros. These modes of transcriptional control are probably combined with active protein clearance by degradation (Zacharioudaki, 2012).

An anti-differentiation role has also been proposed for vertebrate homologues of Dpn/E(spl), the Hes proteins. Hes1, Hes5 and Hes3 are all expressed in proliferating neural stem cells of the embryonic CNS. Upon Hes knockout, neural stem cells prematurely differentiate resulting in a hypoplastic nervous system, with increasing severity as more Hes genes are lost. In an interesting analogy, only Hes1 and Hes5 are direct targets of Notch signalling. Another example where anti-differentiation during quiescence is mediated by high Hes1 expression are cultured fibroblasts and rhabdomyosarcoma cells. Similar to what was observed with Dpn/E(spl)-mutant embryos, a quiescence trigger, like serum depletion, can result in irreversible cell-cycle withdrawal, if Hes1 activity is compromised (Zacharioudaki, 2012).

The results have shed light on the paradox of why Notch loss of function has only minor effects in larval neurogenesis, whereas its hyperactivation causes significant overproliferation. Notch loss of function decreases E(spl) expression, leaving Dpn levels unaffected. Furthermore, Notch pathway disruption does not seem to directly affect NB proliferation, as Cyclin E expression is not eliminated. Therefore, Notch signalling from the GMC/iINP to the NB acts to ensure robustness in NB maintenance, in collaboration with Dpn (Zacharioudaki, 2012).

When Notch signalling is aberrantly activated in the GMCs/iINPs, both type I and type II lineages overproliferate, although the former do so with lower penetrance (fewer lineages) and expressivity (smaller clones). Yet, for both types of lineages, E(spl) genes are necessary to implement overproliferation. This is consistent with the hypothesis that ectopic E(spl)/Dpn activity in the GMCs/iINPs inhibits their differentiation and makes them competent to respond to mitogenic stimuli (Zacharioudaki, 2012).

Why are Type II lineages more sensitive than type I lineages to Notch gain of function? A crucial difference between these NBs is the lack of expression of Ase in type II, as its artificial reinstatement can revert the latter to type I-like behaviour. It was recently demonstrated that Ase downregulates E(spl) expression. It is even possible that Ase antagonizes E(spl) proteins post-transcriptionally, as the two can interact and extensive antagonistic interactions. Thus, N hyperactivation will probably cause a smaller increase in E(spl) levels/activity in type I cells, compared with type II. If resistance to differentiation stimuli depends on the level of E(spl)/Dpn activity, this would account for the relative resilience of type I lineages to Notch-induced overproliferation (Zacharioudaki, 2012).

Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).

The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).

In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).

Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).

Regulation of deadpan by Lozenge

Runx proteins have been implicated in acute myeloid leukemia, cleidocranial dysplasia, and stomach cancer. These proteins control key developmental processes in which they function as both transcriptional activators and repressors. How these opposing regulatory modes can be accomplished in the in vivo context of a cell has not been clear. The developing cone cell in the Drosophila visual system was used to elucidate the mechanism of positive and negative regulation by the Runx protein Lozenge (Lz). A regulatory circuit is described in which Lz causes transcriptional activation of the homeodomain protein Cut, which can then stabilize a Lz repressor complex in the same cell. Whether a gene is activated or repressed is determined by whether the Lz activator or the repressor complex binds to its upstream sequence. This study provides a mechanistic basis for the dual function of Runx proteins that is likely to be conserved in mammalian systems (Canon, 2003).

To understand negative regulation by the Lz protein, regulation of the deadpan (dpn) gene was investigated. In wild-type eyes, Dpn is expressed in photoreceptors R3/R4 and R7. In lz mutants, dpn is also ectopically activated in cone cells, suggesting that Lz either directly or indirectly represses dpn in these cells. Dpn was therefore used as a marker to investigate negative regulation by Lz (Canon, 2003).

The presence of two perfect consensus Runx protein-binding sites (5'-RACCRCA-3') upstream of the dpn-coding region suggested possible direct negative regulation by Lz. Gel-shift experiments showed that Lz specifically binds to both sites. To determine whether these sequences are required for proper dpn regulation, lacZ reporter constructs were made driven by dpn upstream and intronic fragments, and these were transformed into flies. A 4667-bp upstream fragment plus intron I (227 bp) caused expression of lacZ in R3/R4 and R7 faithfully recapitulating the pattern of wild-type dpn expression in the eye. This site is therefore referred to as the dpn eye enhancer (DEE). When the two Lz-binding sites (LBS) in the DEE were mutated (to 5'-RAAARCA-3'; DEE-MutLBS), lacZ expression was also seen in cone cells. Therefore, lack of Lz binding to this enhancer will cause its derepression in cone cells, establishing that Lz directly represses transcription of dpn in cone cells (Canon, 2003).

Like all Runx proteins, Lz contains the conserved C-terminal pentapeptide motif VWRPY, which binds the global corepressor Groucho (Gro). Gro does not bind DNA on its own, but functions as a repressor for sequence-specific DNA-binding factors. Gro is expressed ubiquitously and has early pleiotropic roles in eye development, such as mediating repression by bHLH proteins, making it difficult to study possible involvement of Gro in cone cell development in loss-of-function mutant clones in the eye. Therefore the Gro-interaction domain at the C terminus of Lz was altered from VWRPY to VWEAA, a change that abrogates Gro binding to bHLH proteins. Lz-EAA protein was then expressed under the control of the endogenous eye-specific lz enhancer and its ability to repress dpn was tested in vivo. Whereas a wild-type lz⁺ transgene efficiently represses dpn in cone cells, Lz-EAA was unable to keep dpn off in these same cells. Neuronal differentiation occurs normally in both cases as determined by the neural marker Elav. This shows that the C terminus of Lz, a known Gro-interaction domain, is required for Lz-mediated repression of dpn. The activation function of Lz-EAA, as determined by its ability to activate D-Pax2 expression, remains intact. Therefore, Gro mediates repression by Lz as it does for other Runx proteins. It still remained unclear, however, why in the same cell Lz represses dpn transcription while it directly activates D-Pax2. Clearly, the presence of Gro alone does not cause Lz to become a dedicated repressor in the cone cell (Canon, 2003).

Hairy-related proteins constitutively bind Gro through the conserved sequence WRPW, and function as dedicated repressors. To further address the significance of the C terminus of Lz, the C-terminal amino acids of Lz were changed from WRPY to WRPW to resemble Hairy-related repressors. As a correlate, a Lz-VP16 fusion was made, with the potent activation domain of VP16 fused onto the C terminus of Lz. The ability of Lz-WRPW and Lz-VP16 to regulate Lz targets was tested in vivo. Lz-WRPW efficiently represses dpn in cone cells like the wild-type Lz⁺ but was unable to activate expression of D-Pax2. In contrast, Lz-VP16 failed to repress dpn in cone cells but effectively activates D-Pax2 in cone cells. Therefore, Lz-WRPW functions as a dedicated repressor, and Lz-VP16 as a constitutive activator. These results suggest that Runx-Gro interactions are regulated, because wild-type Runx proteins function as both activators and repressors (Canon, 2003).

The Lz-binding sites in the dpn and D-Pax2 enhancers were compared and distinct differences were found in the neighboring sequences. In the dpn enhancer, each Lz-binding site is followed by AT-rich sequences that are similar to each other (5'-AATCTTT-3' and 5'-TAATCTT-3'). In contrast, sequences near the three Lz-binding sites in the D-Pax2 enhancer, a positively regulated enhancer, are dissimilar and are not as rich in AT sequences. To determine if the difference in these sequences influences the mode of Lz regulation, both AT-rich sequences in the DEE were replaced with the corresponding sequence (GCTG) from the D-Pax2 enhancer. When transformed into flies, the resulting DEE-MutAT enhancer could not support repression of the reporter gene in cone cells. This was the same phenotype that was seen when the Lz-binding sites were mutated in the DEE. In this case, however, alteration of the AT-rich sites had no effect on Lz binding. Therefore, disruption of the AT-rich sequences in the DEE prevents repression of this enhancer by a mechanism that is independent of Lz binding. It is concluded that a cofactor binds to the AT-rich regions next to the Lz-binding sites and is essential for mediating repression of dpn in cone cells (Canon, 2003).

Next, whether it was possible for the dpn enhancer to be repressed independently of the AT-rich sequences was investigated. Lz-WRPW has been shown to function as a dedicated repressor in cone cells. The ability of Lz-WRPW to regulate DEE-MutAT was tested. Significantly, although wild-type Lz failed to repress DEE-MutAT, Lz-WRPW was effective in repressing this enhancer in cone cells. Therefore, Lz-WRPW is able to repress transcription of the DEE without a requirement for the nearby AT-rich sites (Canon, 2003).

The homeodomain protein Cut is expressed specifically in the four cone cells in the eye and has been shown previously to bind AT-rich sequences. The ability of Cut to bind the AT-rich sequences next to the Lz sites in the DEE was tested. Electromobility-shift assays were conducted using probes containing the Lz-binding sites and adjacent AT sequences from the dpn enhancer. Nuclear extracts of cells transfected with a Cut-expressing vector bind the two AT-rich sequences, and this binding is specific as established by competition assays. Further, extracts from cells transfected with both lz and cut cause a supershifted band, indicating that Lz and Cut can bind together to the same probe (Canon, 2003).

To address the in vivo relevance of these results, FLP/FRT-mediated clones were made in the eye that were mutant for the cut locus. Strikingly, Dpn was ectopically expressed in cone cells in the absence of Cut. This provides genetic proof that, in vivo, Cut represses dpn expression in cone cells. Cut is therefore required along with Lz for repression of dpn in these cells (Canon, 2003).

Interestingly, D-Pax2, which is directly activated by Lz, is needed to activate cut in cone cells. Therefore, although indirectly, Lz positively regulates cut. This presents an interesting developmental circuit in which Lz, acting as a transcriptional activator, causes expression of a cofactor that then binds with Lz to convert it into a direct repressor of transcription. Both the presence of the cofactor and binding sites for this cofactor in the controlling regions of an Lz target gene are required for Lz-mediated repression (Canon, 2003).

This model was then tested in R7 cells where both Dpn and Lz are coexpressed. Here, Lz does not repress dpn, presumably because Cut is absent from R7. Consistent with this notion, mis-expression of Cut in R7 cells using lz-Gal4 causes repression of dpn in these cells. This is not a secondary result of a change in cell fate because the expression of the R7 cell-specific marker Prospero remains unchanged in this genetic background (Canon, 2003).

These results add another level of complexity to recent studies demonstrating a combinatorial code whereby a relatively small number of signaling pathways and activated transcription factors work together to generate unique cell fates. In cone cells, the Notch and EGFR pathways are required along with Lz to activate D-Pax2, and therefore cut. In contrast, the combination of these few inputs is not right for activation of cut in the R7 neurons, and therefore dpn is not repressed. The circuit described here demonstrates a higher order of sophistication necessary for a cell to choose between a neuronal and nonneuronal fate using a very limited number of inputs. Using a self-regulated circuit and just two signaling pathways, a single Runx protein is capable of causing opposing effects on different enhancers in the same cell, resulting in a unique fate (Canon, 2003).

These observations suggest that Gro binds proteins with a WRPW motif in a stable manner and causes constitutive repression as seen for both Lz-WRPW and Hairy-related proteins that contain the WRPW motif. In contrast, Gro interaction with the WRPY motif in Runx proteins requires a cofactor, such as Cut, for stabilization. Therefore, repression is regulated as Runx forms a functional repressor complex with Gro only in the presence of the cofactor Cut. This hypothesis was tested in immunoprecipitation (IP) experiments. On its own, Lz weakly interacts with Gro. In the presence of Cut, however, the Lz-Gro interaction is dramatically increased. As expected, Lz-WEAA did not coimmunoprecipitate with Gro, with or without Cut, and Lz-WRPW interacted strongly with Gro, in both the presence and absence of Cut. These results are entirely consistent with all of the in vivo observations: (1) Lz functions as a repressor only in the cells that express the Cut protein; (2) Lz-WRPW, which functions as a constitutive repressor, can repress DEE-MutAT, in spite of the mutant AT-sites and absence of Cut binding; (3) wild-type Lz does not repress DEE-MutAT because Cut cannot bind, and therefore the Lz-Gro complex is not stabilized (Canon, 2003).

Runx proteins have been shown to act as positive and negative regulators. This study, however, is the first to demonstrate that a Runx protein can act as both a direct transcriptional activator and repressor in vivo in the same cell, and that the repressive role requires involvement of the cofactor Cut. The mechanism unraveled here for a Runx protein is similar to that described for a Rel protein, suggesting a common strategy adopted by transcription factors that switch between positive and negative regulation. Furthermore, Cut is conserved in mammals (called CDP or Cux) and has been implicated in the repression of several genes, including osteocalcin (OC). Interestingly, the OC gene is positively regulated by Runx2. These in vitro studies did not investigate a relationship between Runx and Cux. This analysis of dpn repression by Lz and Cut raises the possibility that mammalian Runx proteins may also switch from activation to repression modes through involvement of Cux proteins. If confirmed, such correlations will prove to be important as the mammalian Runx protein AML-1 (Acute Myeloid Leukemia-1) is the most frequent site of translocations that cause leukemia, and human CutL1 is located in a chromosomal region that is often rearranged in cancers, including myeloid leukemia (Canon, 2003 and references therein).

Transcriptional Regulation

deadpan expression in neuroblasts is regulated by the proneural gene daughterless (Younger-Shepherd, 1992). Late expression in some CNS neurons is independent of daughterless (Bier, 1992).

Neurons and glia are often derived from common multipotent stem cells. In Drosophila, neural identity appears to be the default fate of these precursors. Stem cells that generate either neurons or glia transiently express neural stem cell-specific markers. Further development as glia requires the activation of glial-specific regulators. However, this must be accompanied by simultaneous repression of the alternate neural fate. The Drosophila transcriptional repressor Tramtrack is a key repressor of neuronal fates. It is expressed at high levels in all mature glia of the embryonic central nervous system. Analysis of the temporal profile of Tramtrack expression in glia shows that it follows that of existing glial markers. When expressed ectopically before neural stem cell formation, Tramtrack represses the neural stem cell-specific genes asense and deadpan. Surprisingly, Tramtrack protein levels oscillate in a cell cycle-dependent manner in proliferating glia, with expression dropping before replication, but re-initiating after S phase. Overexpression of Tramtrack blocks glial development by inhibiting S-phase and repressing expression of the S-phase cyclin, cyclin E. Conversely, in tramtrack mutant embryos, glia are disrupted and undergo additional rounds of replication. It is proposed that Tramtrack ensures stable mature glial identity by both repressing neuroblast-specific genes and controlling glial cell proliferation (Badenhorst, 2001).

The timing of Ttk69 shows that it does not initiate glial determination. It has been proposed that Ttk69 is expressed in glia to repress neural identity genes. Lateral glioblasts transiently express neural stem cell markers during their development and can adopt the neuronal fate when the glial-determining pathway is not initiated in gcm mutants. Stable glial identity could require neuronal repression. To determine neuronal-specific genes repressed by Ttk69, an analysis was carried out of how ectopic expression of Ttk69 at various stages of nervous system development affects expression of the hierarchy of neuronal markers. This included the proneural genes of the achaete-scute complex, the pan-neural genes (for example asense) and the mature neuronal markers Elav and the antigen 22C10 (Badenhorst, 2001).

Ectopic expression of Ttk69 at any stage does not prevent neuroblast formation. Thus, expression of Ttk69 before neuroblast formation using Kr-Gal4 does not repress the proneural genes achaete or lethal of scute. Strikingly, however, it does inhibit the pan-neural genes asense, dpn and scratch. Consequently, further neuronal development is inhibited and expression of both mature neuronal markers Elav and 22C10 is ablated. Equivalent results were obtained by ectopically expressing Ttk69 in neuroblasts and their progeny using the sca-Gal4 driver. Such expression almost completely inhibits the normal expression of dpn in the embryonic CNS (Badenhorst, 2001).

If, however, Ttk69 is ectopically expressed after the normal neuroblast expression of asense and deadpan, neurons are not ablated. Thus, directed expression of Ttk69 using elav-Gal4 (which is expressed in all post-mitotic neurons after the phase of pan-neural gene expression does not repress the neural markers Elav, 22C210 or Fasciclin II. This indicates that the neural stem cell-specific genes asense and deadpan are the principal targets of Ttk69 repression in the hierarchy of neural determination. Moreover, neural identity, once conferred, cannot be reversed by Ttk69 overexpression, since Ttk69 expression cannot switch neurons to the alternative glial fate (Badenhorst, 2001).

Neural stem cell transcriptional networks highlight genes essential for nervous system development

Neural stem cells must strike a balance between self-renewal and multipotency, and differentiation. Identification of the transcriptional networks regulating stem cell division is an essential step in understanding how this balance is achieved. It has been shown that the homeodomain transcription factor Prospero acts to repress self-renewal and promote differentiation. Among its targets are three neural stem cell transcription factors, Asense, Deadpan and Snail, of which Asense and Deadpan are repressed by Prospero. This study identifies the targets of these three factors throughout the genome. A large overlap in their target genes was found, and indeed with the targets of Prospero, with 245 genomic loci bound by all factors. Many of the genes have been implicated in vertebrate stem cell self-renewal, suggesting that this core set of genes is crucial in the switch between self-renewal and differentiation. It was also found that multiply bound loci are enriched for genes previously linked to nervous system phenotypes, thereby providing a shortcut to identifying genes important for nervous system development (Southall, 2009).

Recent work on Drosophila neural stem cells (or neuroblasts) has provided important insights into stem cell biology and tumour formation. Neuroblasts divide in an asymmetric, self-renewing manner producing another neuroblast and a daughter cell that divides only once to give post-mitotic neurons or glial cells. During these asymmetric divisions the atypical homeodomain transcription factor, Prospero, is asymmetrically segregated to the smaller daughter cell, the ganglion mother cell (GMC), where it can enter the nucleus and regulate transcription. Neuroblasts lacking Prospero form tumours in both the embryonic nervous system and the larval brain. Using the chromatin profiling technique DamID, together with expression profiling, it has been showm that Prospero represses neuroblast genes and is required to activate neuronal differentiation genes. Therefore, Prospero acts as a binary switch to repress the genetic programs driving self-renewal (by directly repressing neuroblast transcription factors) and to promote differentiation. It was found that Prospero represses the neuroblast transcription factors, Asense, Deadpan and Snail, suggesting that these transcription factors may control genes involved in neural stem cell self-renewal and multipotency (Southall, 2009).

To identify the transcriptional networks promoting neural stem cell fate the binding sites of Asense, Deadpan and Snail were profiled, on a whole genome scale. These three proteins are members of a small group of transcription factors that are expressed in all embryonic neuroblast. The first, Asense, is a basic-helix-loop-helix protein, a member of the achaete-scute complex, and a homologue of the vertebrate neural stem cell factor, Ascl1 (Mash1). Unlike the other members of the achaete-scute complex, Asense is not expressed in proneural clusters in the embryo. Asense expression is initiated in the neuroblast and is maintained in at least a subset of GMC daughter cells. Asense is also expressed in most larval brain neuroblasts but is markedly absent from the DM/PAN neuroblast (Bello, 2008; Bowman, 2008). In these lineages, Asense expression is delayed and the daughter cells (secondary neuroblasts) of the Asense-negative DM/PAN neuroblasts undergo multiple cell divisions, expanding the stem cell pool before producing GMCs (Bello, 2008; Boone, 2008; Bowman, 2008). Ectopic expression of Asense limits the division potential of DM/PAN neuroblast progeny (Bowman, 2008). A study in the optic lobe showed that Asense expression coincides with the upregulation of dacapo and cell-cycle exit. Perhaps in combination, these results suggest that Asense may also have a pro-differentiation role (Southall, 2009).

The second transcription factor, Deadpan, is a basic-helix-loop-helix protein related to the vertebrate Hes family of transcription factors. Deadpan is expressed in all neuroblasts and has been shown to promote the proliferation of optic lobe neural stem cells. Unlike Asense, Deadpan is also expressed in the DM/PAN neuroblasts of the larval brain (Southall, 2009).

The third factor, Snail, is a zinc-finger transcription factor whose vertebrate homologues have roles in the epithelial to mesenchymal transition and in cancer metastasis. The Snail family members (Snail, Worniu and Escargot) are known to regulate neuroblast spindle orientation and cell-cycle progression (Southall, 2009).

To further understand the role of these pan neural stem cell transcription factors, their targets were mapped throughout the genome. This, combined with expression profiling, allows building of the gene regulatory networks governing neural stem cell self-renewal, and enhancement of knowledge of the function and mode of action of these transcription factors in neural stem cells (Southall, 2009).

To identify the genes regulated by Asense, Deadpan and Snail in the embryo, d their binding sites in vivo were mapped by DamID, as has been done previously for Prospero (Choksi, 2006). In brief, DamID involves tagging a DNA or chromatin-associated protein with a Escherichia coli DNA adenine methyltransferase (Dam). Wherever the fusion protein binds, surrounding DNA sequences are methylated. Methylated DNA fragments can then be isolated, labelled and hybridised on a microarray. This study expressed Dam fusion proteins in vivo, in transgenic Drosophila embryos. Methylated DNA fragments from transgenic embryos expressing Dam alone serve as a reference. Target sites identified by DamID have been shown to match targets identified by chromatin immunoprecipitation, by mapping to polytene chromosomes and by 3D microscopy data (Southall, 2009).

In comparing the results for Asense, Deadpan, Snail and Prospero, a high degree of overlap was seen between their targets. The average overlap for the four factors in pairwise comparisons is 40%, with the highest overlap between Deadpan and Snail (66%). The similarity in binding is illustrated by the binding of all four factors to the intronic regions of the cell-cycle regulation gene CycE. 245 genes are bound by all four proteins, including genes involved in neuroblast cell fate determination, cell-cycle control and differentiation. These loci are unlikely to represent regions of chromatin accessible to all transcription factors; only 17/245 (7%) were also bound by another neural transcription factor, Pdm1. The large overlap in the targets of Asense, Deadpan, Snail and Prospero implies that these may be a core set of genes involved in neuroblast self-renewal and differentiation (Southall, 2009).

Genome-wide analysis of Asense DamID peaks shows that Asense binding is associated with increased levels of DNA conservation (determined by the alignment of eight insect species. A representation of Asense binding around a generic gene shows an enrichment of ~2 kb upstream of the transcriptional start site, binding within intronic regions (32%) and also downstream of the gene (20%). This distribution is consistent with transcription factor-binding analysis and regulatory sequence studies in mice and humans (Southall, 2009).

The resolution of DamID is ~1 kb and there are currently no motif discovery tools available that can analyse the large amount of sequence data generated by full genome DamID. Therefore, a motif discovery tool, called MICRA (Motif Identification using Conservation and Relative Abundance) was developed to identify overrepresented motifs in low-resolution data. In brief, 1 kb of sequence from each binding site is extracted and filtered for conserved sequences. The relative frequency of each 6-10 mer is then calculated and compared with background frequency. Using MICRA the E-box, CAGCTG, was identified as the most overrepresented 6 mer in the regions of Asense binding (131% overrepresented using a conservation threshold of 0.6. In support of the in vivo binding data, in vitro studies had previously shown that Asense binds to CAGCTG, which is also the binding site of the vertebrate Asense homologue Ascl1 (Mash1) (Southall, 2009).

A GO annotation analysis of the genes bound by Asense shows a highly significant overrepresentation of genes involved in nervous system development and cell fate determination. Similar analyses were performed for Deadpan and Snail and for both transcription factors; DNA conservation was enriched surrounding their binding sites. Deadpan and Snail targets fall broadly into the same gene ontology classes as Asense and Prospero and the binding peaks show a similar distribution relative to gene structure as for Asense. Motif discovery using MICRA identifies sites consistent with previously published in vitro studies for Deadpan (CACGCG and CACGTG) and Snail (CAGGTA). These analyses provide unbiased support for the Deadpan and Snail DamID experiments (Southall, 2009).

When comparing the data sets for Asense, Deadpan, Snail and Prospero genomic loci in which multiple transcription factors bind were found. This phenomenon has been described previously in a Drosophila cell line and, more recently, in mouse embryonic stem (ES) cells in which these loci are termed 'multiple transcription factor-binding loci' (MTL). The ES cell MTLs are associated with ES-cell-specific gene expression and are thought to identify genes important for stem cell self-renewal. The data provide an independent and direct, in vivo demonstration of the phenomenon described in these two earlier studies. Analysis of neural MTLs (as determined by binding of Asense, Deadpan, Prospero and Snail within a 2 kb window) shows increased sequence constraint, correlating with the number of transcription factors bound. The increase in conservation is higher than expected solely based on the combined binding sites of the factors studied. This suggests that further factors may bind to these loci. The loci associated with MTLs are enriched for genes required for proper neural development and for viability (Southall, 2009).

To investigate further the relationship between the number of transcription factors bound at a locus and the importance of the associated target gene in neural development, a database (www.neuroBLAST.org) was assembled comprising DamID data, expression profiling of neural transcription factors, and data on Drosophila nervous system development collated from genetic screens, expression screens, gene homology and text mining screens. Using a random permutation algorithm and training sets of known nervous system development genes weighted scores were assiged to each screen. A total score is calculated for each gene, providing an indication of the gene's involvement in nervous system development. Multiple gene lists can be searched in the database, which is a useful method to pinpoint key genes in user generated gene lists (e.g. expression array results) (Southall, 2009).

Using the data collected for the database, a correlation was consistently found between gene sets bound by increasing numbers of transcription factors and genes in Drosophila genetic screens for defects in nervous system development, eye development and cell-cycle progression or in text mining screens (occurrence of the gene or its homologue with neural or stem cell terms; r=0.98) (Southall, 2009).

This study has shown that Asense, Deadpan, Prospero and Snail bind to genes essential for neural development. This finding enables highlighting of novel genes that may be involved in neural development. The neuroBLAST database ranks genes based on the number of transcription factors bound, together with their appearance in external screens. In this way it identifies known key players in neural development such as prospero, brain tumour, miranda, seven up and glial cells missing. The majority of these genes are identified by multiple binding information (DamID data), independent of external screens and weighted scores (Southall, 2009).

Interestingly, there are many high scoring genes that have not previously been characterised for a role in Drosophila neural development. These include CG32158, an adenylate cyclase known to be expressed in the CNS, two putative transcription factors (CG2052 and CG33291), an NADH dehydrogenase (CG2014) and an F-box protein (CG9772). There is also cenG1A, an ARF GTPase activator, is bound by all four transcription factors and is expressed in neuroblasts. CG9650 is bound by Prospero and Deadpan, and is a homologue of the BCL11b oncogene, which is essential for proper corticospinal neuron development in vertebrates. Another high scoring gene identified by this method is canoe (bound by all four transcription factors, neuroBLAST score of 33.7), which has recently been shown to regulate neuroblast asymmetric divisions (Southall, 2009).

Using the binding data for these four transcription factors as a foundation, attempts were made to construct the transcriptional networks governing neural stem cell self-renewal and differentiation. Although DamID reports protein-binding sites, it cannot show how individual target genes are regulated in response to binding. Expression profiling of neuroblasts and GMCs from wild type and mutant embryos can provide this information, and provide greater insight into the biological function of each of the transcriptional regulators (Southall, 2009).

Expression profiling of asense mutants was performed on 50-100 neuroblasts and GMCs microdissected from the ventral nerve cord of stage 11 wild type and mutant embryos. Genes that are bound by Asense exhibited a significant change in expression level in asense mutant neuroblasts and GMCs. In many cases, neuronal differentiation and Notch pathway genes (enhancer of split complex [E(spl)-C] and bearded complex) are upregulated in the mutant, suggesting that Asense normally represses them, whereas neuroblast genes are downregulated, suggesting they require Asense for expression. This contrasts with the data for Prospero, which represses neuroblast genes and is required for the activation of differentiation genes. Combined with the fact that Prospero represses expression of Asense, these data support an antagonistic relationship between Prospero and Asense. For example, the neuroblast genes miranda and grainy head are activated by Asense and repressed by Prospero, whereas transcription of the differentiation gene Fasciclin I is promoted by Prospero but inhibited by Asense. Interestingly, however, there are also examples of differentiation and cell-cycle exit genes activated by Asense, such as commissureless, hikaru genki and dacapo. Furthermore, when the full expression array data from prospero mutants and asense mutants are compared by cluster analysis two clusters were found in which genes are regulated antagonistically, but also two clusters in which genes are similarily regulated. These data suggest a dual role for Asense: activating the expression of neuroblast genes and repressing differentiation genes in the neuroblast, whereas promoting differentiation when present in the GMC (Southall, 2009).

This study has combined in vivo chromatin profiling and cell-specific expression profiling to identify the gene regulatory networks directing neural stem cell fate and promoting differentiation in the Drosophila embryo. Asense, Deadpan, Snail and Prospero were found to bind to many of the same target genes. The targets of Asense, Deadpan and Snail include neuroblast genes but also many differentiation genes. The binding of these neural stem cell factors to differentiation genes is not entirely unexpected. In vertebrates, stem cell transcription factors bind to and repress differentiation genes to maintain the stem cell state. Additionally, it is becoming apparent that transcription factors can have roles in both activation and repression, in Drosophila and in vertebrate stem cell transcriptional networks. The ability to either repress or activate is likely to be due to interaction with co-factors, and the ability to recruit chromatin remodelling complexes to specific loci (Southall, 2009).

It was shown previously that Prospero represses the expression of Asense and Deadpan in GMCs, supporting a model whereby a core set of genes involved in neuroblast self-renewal and multipotency is activated by the neuroblast transcription factors and repressed by Prospero. This study has shown that, in part, Asense acts oppositely to Prospero, promoting the expression of neuroblast genes and repressing certain differentiation genes. However, the data also indicate that Asense can promote the expression of some genes required for differentiation, including the cell-cycle inhibitor dacapo, which is a member of the p21/p27 family of cdk inhibitors. dacapo expression inititates in the GMC; a reduction was observed in levels of dacapo mRNA in the asense mutant neuroblasts and GMCs, similar to what has been reported in the developing optic lobe. asense mRNA is known to be expressed in at least a subset of GMCs, and Asense protein is present in larval GMCs. This suggests that Asense has a secondary role, to promote GMC cell-cycle exit and differentiation. Asense is absent in larval PAN neuroblasts whose progeny, unlike GMCs, divide in a stem cell-like manner. Ectopic expression of Asense prevents formation of these daughter cells, which can undergo extra divisions (Bowman, 2008), possibly by the upregulation of dacapo, and other differentiation genes (Southall, 2009).

The expression pattern, function and binding site specificity of Asense all correlate strongly with its vertebrate counterpart, Ascl1 (Mash1). Mash1 is expressed in neural precursors in vertebrates, is known to regulate genes involved in Notch signalling (Delta, Jag2, Lfng and Magi1), cell-cycle control (Cdc25b) and neuronal differentiation (Insm1)and recognises the E-box sequence, CAGCTG. Furthermore, Mash1 is consistently found to promote neuronal differentiation, consistent with a pro-differentiation role for Asense. Conversely, it was shown that Asense activates the expression of certain neuroblast genes, such as miranda, which is expressed in all neuroblasts and repressed by Prospero. Deadpan and Snail bind to many neuroblast genes. Given that the expression of deadpan and snail is restricted to pan-neural neuroblasts, it is likely that they can also activate the expression of neuroblast genes. However, confirmation of this awaits expression profiling of deadpan and snail mutant neuroblasts and GMCs (Southall, 2009).

Finally, this study has shown that multiple transcription factor binding is associated with genes that have critical functions in neural development. This relationship can be used to identify novel genes involved in neural development, including those with vertebrate counterparts. A similar gene network and data mining study, using two pair-rule genes in Drosophila, has recently been used to identify a new marker for kidney cancer. Therefore, large-scale analysis of gene regulatory networks, as used here, provides a powerful approach to identifying key genes involved in development and disease (Southall, 2009).

The bHLH factor deadpan is a direct target of Notch signaling and regulates neuroblast self-renewal in Drosophila

A defining feature of stem cells is their capacity to renew themselves at each division while producing differentiated progeny. How these cells balance self-renewal versus differentiation is a fundamental issue in developmental and cancer biology. The Notch signaling pathway has long been known to influence cell fate decisions during development. Indeed, there is a great deal of evidence correlating its function with the regulation of neuroblast (NB) self-renewal during larval brain development in Drosophila. However, little is known about the transcription factors regulated by this pathway during this process. This study shows that deadpan (dpn), a gene encoding a bHLH transcription factor, is a direct target of the Notch signaling pathway during type II NB development. Type II NBs undergo repeated asymmetric divisions to self-renew and to produce immature intermediate neural progenitors. These cells mature into intermediate neural progenitors (INPs) that have the capacity to undergo multiple rounds of asymmetric division to self-renew and to generate GMCs and neurons. The results indicate that the expression of dpn at least in INPs cells depends on Notch signaling. The ectopic expression of dpn in immature INP cells can transform these cells into NBs-like cells that divide uncontrollably causing tumor over-growth. In addition to dpn, Notch signaling must be regulating other genes during this process that act redundantly with dpn (San-Juán, 2011).

During the division of type II NBs the asymmetric sequestration of Numb into one daughter cell ensures that the activity of Notch signaling is restricted to the NBs, whereas it is blocked in the other daughter cell, the immature INP cell. The down-regulation of Notch signaling in this latter cell prevents it being transformed into NBs. When Notch signaling is ectopically expressed in the immature INP, it cannot mature into an INP and it then over-proliferates as NB-like cells. The results indicate that this function of Notch signaling is through Su(H). Evidence is presented that suggests that the bHLH factor dpn is one direct target of Notch signaling during this process. Alterations in the activity of this gene reproduce the effects found when Notch signaling is ectopically activated. In addition, a regulatory region upstream of the transcriptional initiation site was identified that drives the expression of dpn in NBs and INPs, that is directly regulated by Su(H). Altogether, these results lead to the following model: After the asymmetric division of NBs, the down-regulation of Notch signaling in the immature INP prevents the activation of dpn in this cell. This process, which likely occurs in conjunction with other mechanisms that promote Dpn degradation, rapidly eliminates Dpn in immature INP. The loss of Dpn permits the maturation of the immature INP into an INP cell. When Dpn is continuously expressed during asymmetric NB division, either by the activation of Notch signaling or by ectopic expression of Dpn, both recently born cells will express high levels of Dpn. This event can cause the prevention of maturation of immature INP into INP that would cause this cell to adopt its parental NB fate, entering mitosis and initiating over-growth of NB-like cells. Although, these over-growths are mostly constituted by NB-like cells, occasionally INPs (Ase+) and also few Elav positive cells were found. It is thought that the diversity of cell types within clones of dpn-expressing cells is likely due to differentiation of some of the immature INPs contained in these clones. These few escaper cells can give rise to all cell types found in a type II NB lineage (San-Juán, 2011).

A Notch-responsive enhancer has been identified that is contained in a regulatory region upstream of the transcriptional initiation site of dpn. This enhancer drives the expression of dpn in all NBs as well as in INPs, reproducing the pattern of expression of the endogenous Dpn. These data suggest that Notch regulates the expression of dpn in all these cells. However, it was found that in clones of a null allele of Su(H), dpn expression is not altered in NB and is only eliminated in the INPs. This clonal phenotype suggests that Notch signaling might function redundantly with other signals in NB. Thus, it is possible that in NBs multiples enhancers act redundantly to regulate the expression of dpn, and therefore its regulation depends on different signals. For instance, numb and brain tumor seem to function cooperatively to ensure the maturation of immature INP cells. Brat function appears independent of Notch signaling, suggesting that additional signals are required to promote the progression of recently born cells to INPs. Thus, it is possible that several signals function redundantly to ensure that NBs would be generated in appropriate numbers even in the absence of one or more genes (San-Juán, 2011).

According to this model, if dpn were the only target of Notch signaling during NBs proliferation, it would be expected that the loss of dpn would be sufficient to suppress the effects caused by the ectopic activation of the pathway. However, although it was found that in dpn mutant brains the total number of NBs is reduced and type II NBs are not found, clones of dpn mutant cells always contained a single neuroblast. In addition, the loss of dpn is not sufficient to suppress the effects caused by the ectopic activation of Notch. Although the reasons for these relatively mild clonal phenotypes are not fully understood, one possibility is that the system ensures its robustness by the existence of genetic redundancy. This redundancy may occur with other bHLH genes. Some members of the E(spl) complex were tested, and therefore a possible requirement of other members of this complex cannot be ruled out. This redundancy could ensure that neurons would be generated in appropriate numbers (San-Juán, 2011).

Targets of Activity

Deadpan is involved in dosage compensation, the regulation of balance between the function of sex chromosomes and autosomes in both sexes. Deadpan is a negative regulator of Sex-lethal, interacting in this function with scute (Bier, 1992).

Deadpan is implicated in the negative regulation of transcription and has structural affinity to Hairy and Enhancer of split, both of which are involved in negative regulation of neurogenesis (Bier, 1992).

Drosophila sex is determined by the action of the balance between the X chromosome and the autosomes (X:A) on transcription of Sex-lethal, a feminizing switch gene. Loss-of-function mutations in denominator elements of the X:A signal were obtained by selecting for dominant suppressors of a female-specific lethal mutation in the numerator element, sisterlessA (sisA). Ten suppressors were recovered in this extensive genome-wide selection. All were mutations in deadpan, a pleiotropic locus acts as a denominator element. Detailed genetic and molecular characterization is presented of this diverse set of new dpn alleles including their effects on Sxl. Although selected only for impairment of sex-specific functions, all are also impaired in nonsex-specific functions. Male-lethal effects were anticipated for mutations in a major denominator element, but viability of males lacking dpn function is reduced no more than 50% relative to their dpn- sisters. Moreover, loss of dpn activity in males causes only a modest derepression of the Sxl 'establishment' promoter (Sxlpe), the X:A target. By itself, dpn cannot account for the masculinizing effect of increased autosomal ploidy, the effect that gives rise to the concept of the X:A ratio; nevertheless, if there are other denominator elements, these results suggest that their individual contributions to the sex-determination signal are even less than those of dpn. The time course of expression of dpn and of Sxl in dpn mutant backgrounds suggests that dpn is required for sex determination only during the later stages of X:A signaling in males to prevent inappropriate expression of Sxlpe in the face of increasing sis gene product levels (Barbash, 1996).

In addition to deadpan, several other genes encoding transcription factors of the helix-loop-helix (HLH) family: sisterless-b (or as it is also know, scute), daughterless and extramacrochaetae regulate Sex lethal. DA/SIS-B heterodimers bind several sites on the SXL early promoter with different affinities and consequently tune the level of active transcription from this promoter. Repression by the DPN product of DA/SIS-B dependent activation of Sex-lethal results from specific binding of DPN protein to a unique site within the promoter. This contrasts with the mode of emc repression, which inhibits the formation of the DA/SIS-B heterodimers (Hoshijima, 1995).

Basic helix-loop-helix (bHLH) transcription factors are characterized by a conserved four-helix bundle that recognizes a specific hexanucleotide DNA sequence in the major groove. Previous studies have shown that amino acids in the basic region make base-specific contacts, whereas the HLH region is responsible for dimerization. Structural data suggest that portions of the loop region may be proximal to the DNA; however, the role of the loop in DNA-binding affinity and specificity has not been investigated. Protein-DNA recognition by the Drosophila bHLH transcription factor Deadpan was probed using combinatorial solid-phase peptide synthesis methods. A series of bHLH peptide libraries that modulate amino acid content and length in the loop region was screened with DNA and peptide affinity columns, and analyzed using matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS). A functional bHLH peptide with reduced loop length was found, and Lys80 was unambiguously identified as the sole loop residue critical for DNA binding. Unnatural amino acids were substituted at this position to assess contributions of the terminal amino group and the alkyl chain length to DNA-binding affinity and specificity. Using combinatorial solid-phase peptide synthesis methods and MALDI-MS, a key amino acid involved in DNA binding by a bHLH protein has been identified. This approach provides a powerful alternative to current recombinant DNA methods to identify and probe the energetics of protein-DNA interactions (Winston, 2000).

Protein Interactions

Deadpan may be a negative regulator of the achaete-scute complex. It could do this by directly binding to and inhibiting factors that activate AS-C . This interaction has different conseqences, depending on gender. Important here is the ratio of deadpan to scute. Males carrying wild type scute and a deadpan lethal insertion have never been recovered. Females with three copies of wild type scute but homozygous for the deadpan-mutating insertion have improved viability, whereas females with three copies of wild type deadpan and one copy of wild type scute show reduced viability (Bier, 1992).

Hairy, Deadpan and E(SPL) proteins have three evolutionarily conserved domains required for their function: the bHLH, Orange, and WRPW domains. However, the suppression of Scute activity by Hairy does not require the WRPW domain. The Orange domain is an important functional domain that confers specificity among members of the Hairy/E(SPL) family. A Xenopus Hairy homology conserves not only Hairy's structure but also its biological activity. Transcriptional repression by the Hairy/E(SPL) family of bHLH proteins involves two separable mechanisms: repression of specific transcriptional activators, such as Scute, through the bHLH and Orange domains and repression of other activators via interaction of the C-terminal WRPW motif with corepressors, such as the Groucho protein (Dawson, 1995).

The basic helix-loop-helix domain of the Drosophila transcription factor Deadpan was prepared by total chemical protein synthesis in order to characterize its DNA binding properties. Circular dichroism spectroscopy was used to correlate structural changes in Dpn with physiologically relevant monovalent (KCl) and divalent (MgCl2) cation concentrations. In addition, electrophoretic mobility shift assay (EMSA) and fluorescence anisotropy methods were used to determine equilibrium dissociation constants for the interaction of Dpn with two biologically relevant promoters involved in neural development and sex determination pathways. In this study, DNA binding conditions were optimized for Dpn, and a markedly higher DNA binding affinity was found for Dpn than reported for other bHLH domain transcription factors. Dpn binds as a homodimer (Kd = 2.6 nM) to double-stranded oligonucleotides containing the binding site CACGCG. In addition, Dpn binds with the same affinity to a single or tandem binding site, indicating no cooperativity between adjacent DNA-bound Dpn dimers. DNA binding was also monitored as a function of physiologically relevant KCl and MgCl2 concentrations, and this activity was found to be significantly different in the presence and absence of the nonspecific competitor poly(dI-dC). Moreover, Dpn displays moderate sequence selectivity, exhibiting a 100-fold higher binding affinity for specific DNA than for poly(dI-dC). This study constitutes the first detailed biophysical characterization of the DNA binding properties of a bHLH protein (Winston, 1999).

Yeast SIR2 (Silent Information Regulator 2) is a nicotinamide adenine dinucleotide (NAD)⁺-dependent histone deacetylase required for heterochromatic silencing at telomeres, rDNA, and mating-type loci. The Drosophila Sir2 also encodes deacetylase activity and is required for heterochromatic silencing, but unlike ySir2, is not required for silencing at telomeres. Drosophila Sir2 interacts genetically and physically with members of the Hairy/Deadpan/E(Spl) family of bHLH euchromatic repressors, key regulators of Drosophila development. Drosophila Sir2 is an essential gene whose loss of function results in both segmentation defects and skewed sex ratios, associated with reduced activities of the Hairy and Deadpan bHLH repressors. These results indicate that Sir2 in higher organisms plays an essential role in both euchromatic repression and heterochromatic silencing (Rosenberg, 2002).

HES family repressors are involved in a number of important developmental processes, including sex determination. Dpn acts as a 'denominator' or negative regulatory element in the process of Drosophila sex determination in which the balance of X-encoded activators, or 'numerator' elements, and autosomally encoded denominator elements regulate the transcription of a master control gene called Sex lethal (Sxl). Sxl activity is required for female development and is expressed in all cells in females, whereas males do not require Sxl activity and do not express active Sxl protein. Loss of Dpn function results in inappropriate activation of Sxl expression, which in turn leads to aberrant dosage compensation and male specific lethality. Since Sir2 interacts physically with Dpn, it is expected that if Dpn requires Sir2 activity to function in sex determination, then lowering Sir2 gene dosage would result in fewer male progeny. Consistent with this hypothesis, a marked decrease is found from the expected number of adult loss-of-function (LOF) Sir2 male progeny and male Sir2 embryos stained for Sxl exhibit ectopic Sxl expression. If Sir2 is involved in assessing the balance of X:A factors in sex determination, it might be expected that overexpression of Sir2 would repress Sxl, resulting in female specific lethality. Indeed, it is found that when Sir2 is overexpressed, female embryos exhibit reduced Sxl expression (Rosenberg, 2002).

Drosophila CK2 phosphorylates Deadpan, raising the possibility that Dpn repressor functions might be regulated by phosphorylation

In Drosophila, protein kinase CK2 regulates a diverse array of developmental processes. One of these is cell-fate specification (neurogenesis) wherein CK2 regulates basic-helix-loop-helix (bHLH) repressors encoded by the Enhancer of Split Complex [E(spl)C]. Specifically, CK2 phosphorylates and activates repressor functions of E(spl)M8 during eye development. This study describes the interaction of CK2 with an E(spl)-related bHLH repressor, Deadpan (Dpn). Unlike E(spl)-repressors which are expressed in cells destined for a non-neural cell fate, Dpn is expressed in the neuronal cells and is thought to control the activity of proneural genes. Dpn also regulates sex-determination by repressing sxl, the primary gene involved in sex differentiation. Dpn is weakly phosphorylated by monomeric CKalpha, whereas it is robustly phosphorylated by the embryo holoenzyme, suggesting a positive role for CK2beta. The weak phosphorylation by CK2_ is markedly stimulated by the activator polylysine to levels comparable to those with the holoenzyme. In addition, pull down assays indicate a direct interaction between Dpn and CK2. This is the first demonstration that Dpn is a partner and target of CK2, and raises the possibility that its repressor functions might also be regulated by phosphorylation (Karandikar, 2005).

A subset of E(spl)-repressors, i.e., M5, M7, and M8, robustly interact with CK2alpha (Trott, 2001). In addition, these three proteins are equivalently phosphorylated by monomeric CK2alpha or the holoenzyme at a conserved CK2 site that is located in close proximity to the C-terminal Groucho binding WRPW motif. Furthermore, deletion of the CK2 site (SDCD) or replacement of the CK2 phosphoacceptor in M8 with Asp abolishes interaction, suggesting that the CK2-site might, by itself, confer interaction. Given the overall structural conservation of the HES family, i.e., E(spl), Dpn, and Hairy, the sequence of Dpn was analyzed to determine the presence of CK2 sites and their positional conservation, if any. This analysis revealed the presence of two potential sites, i.e., S9DDD and S408DCS411LDE. While the N-terminal site satisfies the requirement for an Asp/Glu at the n+1 and n+3 positions, the C-terminal site is lacking Asp/Glu at the n + 1. However, it is noted that a number of substrates where the n + 1 position is not an Asp/Glu have been identified. In Dpn, the first site is adjacent to the basic domain and harbors a single potential phosphoacceptor (Ser9). In contrast, the second site is located in the vicinity of the Groucho binding WRPW motif and contains two potential phosphoacceptors (Ser408 and Ser411) that might be subject to hierarchical phosphorylation by CK2. Interestingly, the second site localizes to a region of Dpn which, although hypervariable amongst HES members, is positionally conserved in a number of repressors (M5/7/8, Hes6, etc.). In the case of M8 and its murine homolog Hes6, this site is targeted by CK2 in vitro, and its perturbation dramatically affects Hes6 and M8 repressor activity in vivo (Karandikar, 2005).

Given the strong two hybrid interaction of E(spl)M5/7/8 with CK2, and the fact that interaction required integrity of the CK2 site, it was asked whether Dpn is also a partner of CK2. However, in an explicit test it was observed that strength of the (two hybrid) interaction between LexA-Dpn and AD-CK2alpha appears marginal when compared to that between LexA-M8 and AD-CK2alpha. This result is surprising because Dpn contains two CK2 sites, both of which are significantly more acidic than the single site in M5/7/8. It was reasoned that the significantly attenuated Dpn-CK2alpha interaction might reflect attenuated expression and/or instability of Dpn in yeast, or, perhaps, its ability to act as a repressor in yeast. An alternative possibility is that this interaction also requires CK2beta. If so, a direct biochemical route might be more informative to assess targeting of Dpn by CK2 (Karandikar, 2005).

To test if Dpn is a CK2 target an in vitro phosphorylation assay was performed. GST and GST-Deadpan were subjected to phosphorylation using purified monomeric CK2alpha or CK2 holoenzyme. The former isoform is relevant to the two hybrid analysis, whereas the latter isoform mimics the environment most likely to be encountered in vivo and thus might be considered to be physiologically more relevant. The results indicate that GST-Dpn is phosphorylated weakly by monomeric CK2alpha, whereas it was robustly phosphorylated by the embryo-holoenzyme. No phosphorylation of the GST affinity tag was observed for either isoform of CK2. These results suggest that phosphorylation of Dpn by CK2 is positively influenced by the beta subunit, and might explain its 'weak' interaction with CK2alpha in yeast. It is not considered likely that Dpn interacts exclusively via CK2beta, because CK2alpha exhibits phosphorylation of this bHLH protein, albeit weakly. The more likely scenario is that the Dpn interacts with CK2 via a binding site encompassing both subunits, i.e., the holoenzyme. Because this is the in vivo conformation of CK2 strengthens the notion that Dpn is a CK2 target. Comparative kinetic analysis with the two isoforms will be needed to address how CK2beta enhances interaction and phosphorylation of Dpn (Karandikar, 2005).

Although the phosphorylation analysis suggests that Dpn interacts preferentially with the holoenzyme, two hybrid analysis with this isoform per se has been precluded because yeast strains that express equivalent amounts of CK2alpha and CK2beta are currently unavailable. Therefore the ability of Dpn to form a direct complex with embryo-CK2 or CK2alpha was assessed. GST-alone and GST-Dpn were purified, immobilized on glutathione-sepharose, and tested for complex formation with the two isoforms of CK2. The presence of CK2 in the bound (pellet) and unbound (supernatant) fractions was assessed by Western blotting using an antisera that recognizes both (alpha and beta) subunits of CK2. Incubation of GST-Dpn beads withCK2alpha resulted in a minor amount of immunoreactive material in the pellet. In contrast, incubation of GST-Dpn beads with embryo-CK2 resulted in significantly greater amounts of immunoreactive material in the pellet, demonstrating that Dpn and CK2-holoenzyme interact directly. These binding data appear to qualitatively mirror the phosphorylation data, and it is estimated that ~20% of the holoenzyme interacted with Dpn. Given the experimental conditions of these assays, CK2-holoenzyme contributed half the amount of catalytic subunit compared to CK2alpha alone, suggesting that complex formation appears to be relatively efficient for the holoenzyme. These results demonstrate that the Dpn-CK2 interaction is direct. In addition, complex formation occurs in the absence of MgATP, in line with previous analysis of the interaction of this enzyme with M5/7/8, ZFP35, etc (Karandikar, 2005).

The observations of a direct CK2-Dpn complex and its preferential phosphorylation by the holoenzyme, suggest a positive role for CK2beta. The marginal ability of CK2alpha to phosphorylate Dpn, and the fact that CK2beta mediates activation by polybasic effectors, led to an assessment of whether phosphorylation was responsive to polybasic activation. The marginal phosphorylation of Dpn by CK2alpha was unaffected by either spermine or protamine, but was dramatically stimulated by poly(DL)lysine. The stimulatory effects of poly(DL)lysine are not due to non-specific phosphorylation, because GST is not phosphorylated in its presence. In contrast, phosphorylation of Dpn by embryo-CK2 was unresponsive to further activation by these effectors. These results suggest that phosphorylation of Dpn by embryo-CK2 is unresponsive to further activation, and support the notion that substrates that are efficiently phosphorylated, e.g., the RII subunit of PKA, topoisomerase II, etc., are generally refractory to these activators (Karandikar, 2005).

While the mechanism by which Dpn functions during neurogenesis remains to be resolved, its role(s) during sex determination is much better understood. In either case, however, one common feature of its functions is antagonism of ASC, whereby Dpn represses transcription of ASC via DNA-binding. In line with this, ectopic expression of dpn reduces ASC activity, suggesting a negative interaction between these two loci. It is noteworthy that a similar function is ascribed to HES repressors as well, although in their case DNA-binding as well as direct interactions with proneural factors (ASC and Atonal) are known to be required for antagonism (Karandikar, 2005).

How might phosphorylation of Dpn regulate its in vivo functions? It is difficult to propose this with certainty based solely on in vitro analysis. However, based on the extensive body of genetic and molecular analysis on Dpn to date, and the emerging notion that CK2 profoundly influences the activity of the related repressor, E(spl)M8, during eye development (Karandikar, 2004), some possibilities can be predicted. As stated above, CK2 phosphorylation regulates repressor activity of M8 and replacement of the phosphoacceptor with Asp generates a dominant allele that is severely exacerbated for its antineurogenic functions. A similar CK2 dependent mechanism might also underlie the interaction of M8 with the ASC-bHLH activator, Lethal of Scute. In a similar vein, it is conceivable that phosphorylation of Dpn might augment its ability to antagonize ASC-derived bHLH activators by either modulating DNA binding or direct protein-protein interactions. CK2 is known to regulate DNA-binding as well as protein-protein interactions (Karandikar, 2005).

The development of nervous system is regulated by the interplay between proneural proteins and their repressors. A general strategy during neurogenesis appears to be the conferring of neural potential on a field of cells, from which arises a precise pattern of neural and accessory cell fates through this interplay and, as such, this mechanism also appears to be involved in other cell fate decisions. It is increasingly becoming apparent that cell fate choice is unlikely to be based simply on the levels of an activator versus its cognate repressor. Rather, this interplay must also be modulated in a spatial and temporal context. In such a scenario, regulation of protein turnover, presence or absence of cofactors, and regulatory modifications, are among those factors that might provide a means to achieve 'fine tuning' of this interplay. In this context, protein kinases and/or phosphatases might provide a simple bistable mechanism to 'fine tune' the developmental outcome. Such a mechanism is beginning to emerge for regulation of repression by E(spl)M8 and its mammalian counterpart, Hes6. In both, phosphorylation by CK2 regulates their ability to interact with and antagonize proneural factors. Given the expanding repertoire of HES proteins that are targeted by CK2, it would not come as a surprise that a similar mechanism might also be employed for regulation of another HES member, Dpn (Karandikar, 2005).

Among the HESmembers that are CK2targets, Dpn differs from E(spl) in a number of ways. While E(spl) transcription [by Su(H)] occurs in response to an activated Notch receptor, Dpn has been thought to be Notch-independent, although it contains binding sites for Su(H) in a region that recapitulates PNS/CNS specific expression. Furthermore, E(spl) repressors block proneural proteins in cells undergoing lateral inhibition, whereas Dpn achieves a similar outcome but in neural cells. The remarkable conservation of CK2 by itself, and its ability to modulate the activity of repressors in different developmental contexts might be indicative of its selection as a general modulator of cell fate determination (Karandikar, 2005).

The bHLH factors Dpn and members of the E(spl) complex mediate the function of Notch signalling regulating cell proliferation during wing disc development

The Notch signalling pathway plays an essential role in the intricate control of cell proliferation and pattern formation in many organs during animal development. In addition, mutations in most members of this pathway are well characterized and frequently lead to tumour formation. The Drosophila imaginal wing discs have provided a suitable model system for the genetic and molecular analysis of the different pathway functions. During disc development, Notch signalling at the presumptive wing margin is necessary for the restricted activation of genes required for pattern formation control and disc proliferation. Interestingly, in different cellular contexts within the wing disc, Notch can either promote cell proliferation or can block the G1-S transition by negatively regulating the expression of dmyc and bantam micro RNA. The target genes of Notch signalling that are required for these functions have not been identified. This study shows that the Hes vertebrate homolog, deadpan (dpn), and the Enhancer-of-split complex (E(spl)C) genes act redundantly and cooperatively to mediate the Notch signalling function regulating cell proliferation during wing disc development (San Juan, 2012).

Deadpan contributes to the robustness of the Notch response

Notch signaling regulates many fundamental events including lateral inhibition and boundary formation to generate very reproducible patterns in developing tissues. Its targets include genes of the bHLH hairy and Enhancer of split [E(spl)] family, which contribute to many of these developmental decisions. One member of this family in Drosophila, deadpan (dpn), was originally found to have functions independent of Notch in promoting neural development. Employing genome-wide chromatin-immunoprecipitation, this study has identified several Notch responsive enhancers in the bHLH hairy and Enhancer of split (E^spl) family gene dpn, demonstrating its direct regulation by Notch in a range of contexts including the Drosophila wing and eye. dpn expression largely overlaps that of several E^spl genes and the combined knock-down leads to more severe phenotypes than either alone. In addition, Dpn contributes to the establishment of Cut expression at the wing dorsal-ventral (D/V) boundary; in its absence Cut expression is delayed. Furthermore, over-expression of Dpn inhibits expression from E^spl gene enhancers, but not vice versa, suggesting that dpn contributes to a feed-back mechanism that limits E^spl gene expression following Notch activation. Thus the combined actions of dpn and E^spl appear to provide a mechanism that confers an initial rapid output from Notch activity which becomes self-limited via feedback between the targets (Babaoglan, 2013).

HES genes are well-known targets of Notch activity. However, in Drosophila only the bHLH genes within the E(spl) Complex were originally thought to be directly downstream of Notch. The expression of another HES genes, dpn, appeared independent of Notch and indeed was associated with cells where Notch activity is considered to be down-regulated (embryonic neuroblasts). More recently it has emerged that dpn expression is under Notch regulation in some contexts (San Juan, 2012; Zacharioudaki, 2012). The current results extend these findings by demonstrating that dpn is directly bound by Su(H) in vivo. As the Su(H) occupied regions differ according to the tissue-type, it appears that dpn contains several Notch responsive enhancers, and the results demonstrate that these direct Notch-dependent expression in different subsets of tissues. Nevertheless, it is striking that a single dpn enhancer, dpn[b] exhibits Notch related expression in both the eye and the wing discs yet these patterns are characteristic of distinct genes/enhancers from the E(spl) Complex (Babaoglan, 2013).

Despite the clear regulation by Notch, there is however relatively few phenotypes resulting from loss of dpn in many tissues. For example, both the wing and eye disc exhibit robust expression of dpn but neither exhibit phenotypes when dpn function was ablated. However, genetic interactions demonstrate that dpn function is related to Notch and both the current evidence, and that from recent studies (San Juan, 2012; Zacharioudaki, 2012), indicate that it has partially redundant functions with the E(spl) genes. This is exemplified by the fact that absence of dpn or of E(spl) Complex alone has little effect on the D/V boundary, but the combined knock down leads to loss of key gene expression (Babaoglan, 2013).

What then is the relevance of dpn in these contexts, especially given that there are 7 E(spl)bHLH genes that also appear to have largely redundant functions? Two components to dpn function are proposed to explain its importance in the Notch response. Clues for the first come from the fact that subtle phenotypes were detected from reductions in dpn when early developmental stages were analyzed. Thus the absence of dpn led to a delay in the ability of Notch to up-regulate cut. Earlier studies also demonstrated a subtle decrease in cut expression in cells lacking E(spl) genes. These results could be explained if both E(spl) and dpn make a contribution to cut regulation. It is suggested that this must be indirect, via the inhibition of a repressor, since both dpn and E(spl)bHLH are thought to be dedicated repressors. So far, no other repressor has been identified that could act as an intermediary (Babaoglan, 2013).

The second component of dpn function is suggested by the observation that Dpn can repress the enhancers derived from E(spl)bHLH genes but not vice versa. Futhermore, it was observed that cells with high levels of Dpn often had lower levels of E(spl)bHLH on a cell by cell level. It is therefore proposed that there is a direct regulatory relationship between dpn and E(spl)bHLH, whereby dpn represses E(spl)bHLH expression. This could set a maximum threshold for E(spl) gene expression since, in previous studies, it was found that dpn shows a less rapid up-regulation following Notch activation than the E(spl) genes. This is reminiscent of the differences seen between HES gene responses in the oscillatory clock involved in somitogenesis and suggests that similar HES gene cross-regulatory network may underpin other Notch dependent processes (Babaoglan, 2013).

DEVELOPMENTAL BIOLOGY

Embryonic

Zygotic expression of deadpan at the syncytial stage is found at low levels throughout the embryo, with the exception of the pole cells. deadpan transcription soon fades, but then reappears in a striped pattern during the middle of cell cycle 13, with 8 stripes of cells arrayed along the anterior-posterior axis. deadpan transcripts are concentrated in the apical region of expressing cells. This pattern fades and deadpan is then expressed in neuroectodermal cells, confined to neuroblasts. By 7 hours all neuroblasts express deadpan, but again this fades as primary neural precursors disappear. Finally deadpan is again expressed in the peripheral and central nervous systems as neurons begin to differentiate (Bier, 1992).

deadpan is expressed at several stages prior to neurogenesis. The earliest zygotic expression occurs in the precellular blastoderm during nuclear division cycle 13 and is nearly ubiquitous. This initial zygotic expression has been found to be involved in sex determination, acting as an autosome counting element to set the X/A ratio. dpn is then expressed in a transient gap gene-like pattern, from which emerges a set of eight pair-rule stripes. No function is apparent for this pair-rule pattern of dpn expression. dpn expression fades as germband extension begins and reappears shortly, in a set of proneural-like patches prior to the first neural precursor delaminations. Expression is quickly limited to these S1 neuroblasts as they delaminate. As further neuroblasts delaminate, they also begin expressing dpn. By late germband extension, dpn expression in CNS neuroblasts consists of a 'rosette' pattern of dpn-expressing cells in each hemisegment. The absence of labelled cells in the center of the rosettes is attributed to the lack of dpn expression in GMCs based on the following evidence: dpn is not expressed in identified secondary precursors of the PNS; dpn has been shown to be absent from GMCs when they can be easily visualized during larval development; and only large cells with the appearance of neuroblasts are visualized with either endogenous dpn probes or the reporter gene probes at early stages of development. Although dpn expression from some GMCs cannot be strictly excluded, absence of expression in these cells is the most likely basis for the differences between dpn and scrt expression during stage 11. At this stage, the first PNS precursors delaminate as one, then two dpn-expressing cells per hemisegment. During embryonic stage 12 (germband retraction), subsequent groups of primary PNS precursors delaminate and express dpn. Secondary PNS precusors do not appear to express dpn. This fact is most clearly evident in the transient expression of dpn in the first PNS precursor cells (A and P cells), which disappear before the next PNS precursors are formed. Thus, in these cells, dpn expression is lost either prior to the cell division, giving rise to secondary precursors, or shortly after this division. After complete germband retraction, postmitotic neurons in both CNS and PNS again express dpn for a brief period prior to developing their final morphologies. dpn expression then fades and is not expressed again until the third larval instar (Emery, 1995).

Larval

In leg imaginal discs, deadpan is expressed in non-neuronal cells, forming a pattern resembling that of hairy (Bier, 1992).

Identification of Drosophila type II neuroblast lineages containing transit amplifying ganglion mother cells

Mammalian neural stem cells generate transit amplifying progenitors that expand the neuronal population, but these type of progenitors have not been studied in Drosophila. The Drosophila larval brain contains 100 neural stem cells (neuroblasts) per brain lobe, which are thought to bud off smaller ganglion mother cells (GMCs) that each produce two post-mitotic neurons. This study used molecular markers and clonal analysis to identify a novel neuroblast cell lineage containing transit amplifying GMCs (TA-GMCs). TA-GMCs differ from canonical GMCs in several ways: each TA-GMC has nuclear Deadpan, cytoplasmic Prospero, forms Prospero crescents at mitosis, and generates up to 10 neurons; canonical GMCs lack Deadpan, have nuclear Prospero, lack Prospero crescents at mitosis, and generate two neurons. It is concluded that there are at least two types of neuroblast lineages: a Type I lineage where GMCs generate two neurons, and a type II lineage where TA-GMCs have longer lineages. Type II lineages allow more neurons to be produced faster than Type I lineages, which may be advantageous in a rapidly developing organism like Drosophila (Boone, 2008).

During a clonal analysis of a larval neuroblast self-renewal mutant it was realized that wild type brains have two distinct types of neuroblast lineages. Mosaic analysis with repressible cell marker (MARCM) was used to generate GFP-marked single cell clones in the larval brain. Depending on the cell in which chromosomal recombination occurs, it is possible to label a single neuroblast and all its progeny, a single GMC and all its progeny, or a single neuron derived from a terminal mitosis. A low density of clones was induced randomly throughout the brain at either mid-first or mid-second larval instar and all clones were assayed 48 h after induction. Two distinct neuroblast lineages were found: a 'Type I' lineage that matches previously reported neuroblast lineages, and a novel 'Type II' lineage that is larger and more complex (Boone, 2008).

Type I neuroblast clones always contained one large neuroblast near the surface of the brain that had nuclear Dpn and cytoplasmic Pros. These clones always contained a column of smaller cells that lacked Dpn and had nuclear Pros, with the occasional presence of a single Dpn+ small cell contacting the neuroblast, which is likely to be a newborn GMC. The cells furthest from the neuroblast were Dpn Pros mature neurons that extend GFP1 axons into the central brain. Type I neuroblast lineages are the sole occupants of the dorsoanterior lateral (DAL) brain region, but can also be found in all other brain regions. To minimize regional variation in neuroblast lineages. Analysis of Type I neuroblasts was restricted to the DAL region (Boone, 2008).

Type I GMC clones were assayed only in the DAL region, where no Type II neuroblasts were observed. All clones lacking a large Dpn+ neuroblast were considered to be GMC clones, and these GMC clones generated at most just two cells. Thus, Type I lineages are identical to those reported for Drosophila embryonic neuroblasts, larval mushroom body neuroblasts, and grasshopper neuroblasts (Boone, 2008).

Type II neuroblast clones always contained one large Dpn+ neuroblast near the surface of the brain, but also contained a distinctive group of small Dpn+ cells that lack nuclear Pros. There are also usually 1-2 small cells in direct contact with the neuroblast that lack both Dpn and nuclear Pros. These two types of small cells are never observed in Type I clones and are a defining feature of Type II clones. Type II neuroblast clones are found in several brain regions, including a cluster within the DPM region. One Type II neuroblast appears to be the previously identified DPMpm1 neuroblast based on its distinctive axon projection that bifurcates over the medial lobe of the mushroom body before crossing the midline (Boone, 2008).

Type II GMC clones were identified by the lack of a large Dpn+ neuroblast. All brain regions that contained Type II neuroblast lineages produced GMC clones of greater than two cells; all brain regions that lacked Type II neuroblast lineages never generated >2 cell GMC clones. Type II GMC clones often contained Dpn+ Proscyto small cells that are unique to Type II neuroblast lineages, confirming that these clones are sublineages of a Type II neuroblast lineage. It is concluded that Type II neuroblasts generate GMCs that produce more than two neurons. Because Type II GMC clones could generate several fold more neurons than a Type I GMC, they were called 'transit amplifying GMCs' or TA-GMCs (Boone, 2008).

TA-GMC clones also contained small cells with nuclear Pros; it is suggested that these cells are equivalent to Type I GMCs based on their cell division profile, and because two cell clones were observed in regions of the brain that contained Type II neuroblast lineages. However, the possibility that some of these nuclear Pros cells are post-mitotic immature neurons cannot be ruled out (Boone, 2008).

If Type II lineages generate TA-GMCs that make an average of twice as many neurons as a Type I lineage, it would be expected that Type II lineages generate approximately twice as many cells over the same timespan compared with Type I lineages. Indeed, it was found that when Type I or Type II clones are grown for the same length of time (between clone induction and analysis), Type II clones generate approximately twice as many neurons. Type I clones in the DAL generate 40.4 +/ 3.1 cells, whereas Type II lineages in the DPM generate 71.2 +/- 6.3 cells . In all cases the final Type I and Type II neuroblast clones contained a single large Dpn+ neuroblast, ensuring that only single neuroblast clones were counted. It is concluded that Type II TA-GMCs generate more neurons than Type I GMCs, and that Type II lineages generate more neurons than Type I lineages (Boone, 2008).

This study characterized the cell division patterns within Type I and Type II lineages to help understand the relationship between different cell types in a lineage. It was first asked what cell type is directly produced by Type I and Type II neuroblasts? Type I neuroblasts in the DAL region always segregate Pros protein into the newborn GMC resulting in easily detectable levels of Pros in neuroblast progeny. Thus, Type I neuroblasts in the DAL generate nuclear Pros+ GMCs, as previously reported. In contrast, Type II neuroblasts of the DPM region often fail to segregate Pros protein, despite proper localization of other apical/ basal proteins, which would account for reduced Pros levels in newborn progeny. The variation in Pros localization among DPM neuroblasts could be due to the presence of some Type I neuroblasts in the region, or actual variation among Type II neuroblasts. It is concluded that Type II neuroblasts divide asymmetrically, but can fail to segregate Pros protein into their newborn progeny (Boone, 2008).

Next, the relationship between the Type II small cells that have high Dpn, low Pros (Dpn+ Proscyto) and those that contain high Pros, but no Dpn (Dpn- Prosnucl), was investiged. It was found that mitotic Dpn+ small cells always form Mira/Pros cortical crescents, with Pins protein localized to the opposite cortical domain, and the spindle aligned along this cortical polarity axis. This type of division is unique to Type II lineages, as all Type I GMCs always showed diffuse cytoplasmic Pros during mitosis. It is concluded that Type II Dpn+ small cells undergo molecularly asymmetric cell divisions to generate a Pros+ sibling and a Pros- sibling. It is proposed that the sibling with little or no Pros remains a Dpn+ TA-GMC, whereas the Pros+ sibling generates one or two post-mitotic neurons, similar to Pros+ GMCs in Type I lineages (Boone, 2008).

To characterize the cell cycle kinetics of Type I GMCs and Type II TA-GMCs, BrdU labeling experiments were performed. Larvae were exposed to a 4.5 h BrdU pulse and then immediately fixed and assayed for BrdU incorporation. As expected, both Type I and Type II neuroblasts always incorporated BrdU. Type I neuroblasts showed only a few closely-associated GMCs labeled, whereas Type II neuroblasts had a much larger number of labeled progeny. It is unlikely that the Type II neuroblasts generate all of these progeny during the 4.5 h labeling window, because the shortest neuroblast cell cycle time observed in any brain region was ~50 min, and thus it is concluded that Type II neuroblast progeny undergo more rounds of cell division that Type I GMCs (Boone, 2008).

To determine if the proliferative Type II neuroblast progeny are competent to differentiate into neurons, a BrdU pulse/chase experiment was performed. Larvae were fed BrdU for 4.5 h as described above, but then allowed to develop for 18 h without BrdU. Type I neuroblasts lacked BrdU incorporation, as expected due to label dilution during the chase interval, but BrdU was maintained in the Elav1 post-mitotic neurons born during the pulse window. Type II neuroblasts and most of their progeny also diluted out BrdU, confirming their status as proliferative cells, and some Elav1 post-mitotic neurons were born during the pulse interval and maintained BrdU labeling. It is concluded that Type II neuroblast progeny are proliferative but can still give rise to differentiated neurons (Boone, 2008).

There are currently no molecular markers that can be used to unambiguously identify Type II neuroblasts. The inability to form Pros crescents may be shared by all Type II neuroblasts, but even so, it would only be a useful marker for mitotic neuroblasts. In the DPM brain region (enriched for Type II lineages) it was found about 50% of the mitotic neuroblasts have little or no Pros crescent, and based on the distinctive lack of Pros in some Type II neuroblast progeny, it is concluded that these are Type II neuroblasts. (The 50% of the DPM neuroblasts that form Pros crescents may be Type I neuroblasts within the region, a special subset of Type II neuroblasts, or there may be stochastic variability in Pros crescent-forming ability among Type II neuroblasts.) In any case, these findings may explain why some labs report seeing Pros crescents whereas others report that neuroblasts do not form Pros crescents; both are correct because there are two types of larval neuroblast lineages (Boone, 2008).

It is unknown whether neuroblasts can switch back and forth between Type I and Type II modes of cell lineage. If the level of Pros in the neuroblast is the key factor distinguishing these modes of division, then experimentally raising Pros levels in Type II lineages may switch them to Type I lineages; conversely, reducing Pros levels in Type I lineages may switch them to Type II lineages. As more brain neuroblasts become uniquely identifiable it will be interesting to address this question. It will also be interesting to search for Type II neuroblast lineages in other insects or crustaceans where Type I neuroblast lineages have been documented (Boone, 2008).

What terminates the TA-GMC lineage? The TA-GMC may fall below a size threshold for continued proliferation. Alternatively, TA-GMCs may lose contact with a niche-derived signal that maintains their proliferation; Hedgehog, Fibroblast growth factor, and Activin are all required for larval brain neuroblast proliferation, but none have been tested for a role in TA-GMC proliferation. Lastly, there may be lineage-specific factors segregated into the TA-GMCs that limit their mitotic potential. TA-GMCs may die at the end of their lineage, as do some neuroblasts, or they may differentiate. It has been shown that loss of Pros and Brat together can generate a more severe neuroblast tumor phenotype than either alone. This suggests that the Type II lineages may be especially sensitive to further loss of differentiation promoting factors due to their low levels of endogenous Pros. Indeed, a dramatic neuroblast tumor phenotype has been observed in type II lineages in lethal giant discs mutants. This raises the question of how Type II lineages benefit the fly. They have the ability to generate more neurons in a faster period of time, due to the presence of TA-GMCs, and may be an evolutionary adaptation to the rapid life cycle of Drosophila. Slower developing insects may not require such rapid modes of neurogenesis (Boone, 2008).

Effects of Mutation or Deletion

deadpan mutants die at various stages of development, but there are no consistant morphological defects (Bier, 1992).

scratch interacts genetically with deadpan. These two genes have similar pan-neural expression patterns but encode unrelated proteins. Loss of function of either of these genes alone does not lead to obvious morphological disruption of the embryonic nervous system. Under optimal conditions, animals homozygous null for each of these genes occasionally complete development and eclose. In contrast, animals null for both genes never hatch and frequently exhibit a dramatic reduction of the nervous system. In addition, axon projections are frequently disorganized. Double mutants have missing and disorganized longitudinal and commissural axon tracts. CNS defects are evident early during neurogenesis as there are fewer hunchback expressing cells contributing to the S1 wave of neuroblasts than in wild type embryos (Roark, 1995).

Deadpan was identified in a genome-wide analyses for transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites

Dendrite arborization patterns are critical determinants of neuronal function. To explore the basis of transcriptional regulation in dendrite pattern formation, RNA interference (RNAi) was used to screen 730 transcriptional regulators and 78 genes involved in patterning the stereotyped dendritic arbors of class I da neurons were identified in Drosophila. Most of these transcriptional regulators affect dendrite morphology without altering the number of class I dendrite arborization (da) neurons and fall primarily into three groups. Group A genes control both primary dendrite extension and lateral branching, hence the overall dendritic field. Nineteen genes within group A act to increase arborization, whereas 20 other genes restrict dendritic coverage. Group B genes appear to balance dendritic outgrowth and branching. Nineteen group B genes function to promote branching rather than outgrowth, and two others have the opposite effects. Finally, 10 group C genes are critical for the routing of the dendritic arbors of individual class I da neurons. Thus, multiple genetic programs operate to calibrate dendritic coverage, to coordinate the elaboration of primary versus secondary branches, and to lay out these dendritic branches in the proper orientation (Parrish, 2006; Full text of article).

To assay for the stereotyped dendrite arborization pattern of class I da neurons (hereafter referred to as class I neurons) in RNAi-based analysis of dendrite development, a Gal4 enhancer trap line (Gal4²²¹) was used that is highly expressed in class I neurons and weakly expressed in class IV neurons during embryogenesis. Because of the simple and stereotyped dendritic arborization patterns of the dorsally located ddaD and ddaE, the studies of dendrite development focused on these two dorsally located class I neurons (Parrish, 2006).

To establish that RNAi is an efficient method to systematically study dendrite development in the Drosophila embryonic PNS, it was demonstrated that injecting embryos with double-stranded RNA (dsRNA) for green fluorescent protein (gfp) is sufficient to attenuate Gal-4²²¹-driven expression of an mCD8::GFP fusion protein as measured by confocal microscopy. Next whether RNAi could efficiently phenocopy loss-of-function mutants known to affect dendrite development was tested. Similar to the mutant phenotype of short stop (shot), which encodes an actin/microtubule cross-linking protein, shot(RNAi) caused routing defects, dorsal overextension, and a reduction in lateral branching of dorsally extended primary dendrites. Likewise, RNAi of sequoia or flamingo resulted in overextension of ddaD and ddaE, RNAi of hamlet resulted in supernumerary class I neurons, and RNAi of tumbleweed resulted in supernumerary class I neurons and a range of arborization defects, consistent with the reported mutant phenotypes. Thus, RNAi is effective in generating reduction of function phenotypes in embryonic class I dendrites (Parrish, 2006).

In addition to genes with functions in promoting dendrite arborization, 20 group A genes were identified that regulate dendrite arborization by limiting dendrite growth and/or branching. Consistent with recent reports that loss of function of the BTB/POZ domain TF abrupt (ab) causes an increase in dendritic branching and altered distribution of branches, it was found that ab(RNAi) altered the arborization of class I dendrites. ab(RNAi) caused an increase in the number and length of lateral branches, expanding the coverage field most noticeably along the anteroposterior (AP) axis. In addition to these defects, ab(RNAi) also caused frequent cell death, consistent with the phenotype observed for a hypomorphic allele of ab (Parrish, 2006).

Increased dendritic branching also resulted from RNAi of several genes known to affect nervous system development, including Adh transcription factor 1 (Adf1), the zinc finger TF nervy (nvy), the basic helix–loop–helix (bHLH) TF deadpan (dpn), as well as genes not previously known to affect neuronal function, such as the putative transcription elongation factor Elongin c. Both Adf1 and dpn mutants have defects in larval locomotion and, in light of recent findings suggesting that da neurons may regulate aspects of larval locomotion, it is possible that dendrite defects underlie these behavioral defects. Consistent with its role in class I dendrite development, dpn is expressed in all PNS neurons. Likewise, nervy has been implicated in regulation of axon branching in motorneurons and is apparently expressed in most neurons. Thus, nervy likely regulates multiple aspects of neuronal differentiation. Finally, Elongin C may regulate transcriptional elongation but also likely functions as a component of a multimeric protein complex that includes the von Hippel-Lindau (VHL) tumor suppressor and targets specific proteins for poly-ubiquitination and degradation. Moreover, BTB/POZ domain proteins (such as cg1841 and ab) function as substrate adaptors for cullin E3 ligases. Interestingly, RNAi of a Drosophila homolog (tango) of a known VHL substrate (HIF-1) also affected dendrite arborization. It thus appears that protein degradation pathways regulate dendrite arborization (Parrish, 2006).

Notch inhibits yorkie activity in Drosophila wing discs

During development, tissues and organs must coordinate growth and patterning so they reach the right size and shape. During larval stages, a dramatic increase in size and cell number of Drosophila wing imaginal discs is controlled by the action of several signaling pathways. Complex cross-talk between these pathways also pattern these discs to specify different regions with different fates and growth potentials. This study shows that the Notch signaling pathway is both required and sufficient to inhibit the activity of Yorkie (Yki), the Salvador/Warts/Hippo (SWH) pathway terminal transcription activator, but only in the central regions of the wing disc, where the TEAD factor and Yki partner Scalloped (Sd) is expressed. This cross-talk between the Notch and SWH pathways is shown to be mediated, at least in part, by the Notch target and Sd partner Vestigial (Vg). It is proposed that, by altering the ratios between Yki, Sd and Vg, Notch pathway activation restricts the effects of Yki mediated transcription, therefore contributing to define a zone of low proliferation in the central wing discs (Djiane, 2014).

In order to investigate the possibility of cross talk between the Notch and Sav/Warts/Hippo (SWH) pathways, the expression pattern of ex-lacZ, a reporter of Yki activity, which reveals the places where SWH activity is lowest was compared with NRE-GFP, which gives a direct read out of Notch activity. In the wing pouch these reporters direct expression in patterns that are complementary. Thus, ex-lacZ expression is completely absent from the dorso-ventral boundary where Notch activity, reported by NRE-GFP, is at its highest. Conversely, in late stage discs, ex-lacZ expression is higher in pro-vein regions where Notch activity (NRE-GFP) is low. Because ex-lacZ gives a mirror image of SWH activity, these results suggest that both Notch and SWH pathways are active together in the D/V boundary and are largely inactive in the pro-veins (Djiane, 2014).

The consequences of modulating Notch activity on the expression of ex-lacZ was tested as an indicator of its effects on SWH pathway. Expression of Nicd, the constitutively active form of the Notch receptor, promoted a strong down-regulation of ex-lacZ in the wing pouch. This effect was stronger in the region surrounding the D/V boundary and weaker towards the periphery. Little down-regulation occurred outside the pouch. Conversely, when Notch activity was impaired, through RNAi mediated knock-down in randomly generated overexpression clones, ex-lacZ levels were up-regulated. This effect was also only evident within the wing-pouch. Notch activity is therefore necessary and sufficient for the inhibition of ex-lacZ in the wing pouch, suggesting that it contributes to the normal down-regulation of ex-lacZ at the D/V boundary (Djiane, 2014).

In the wing pouch, ex-lacZ expression requires Yki. Therefore, to mediate the observed inhibition of ex-lacZ expression, Notch could either exert its actions upstream of Yki, by activating the SWH pathway, or downstream of Yki, by inhibiting Yki's transcriptional activity. To determine which of these alternatives is correct, the consequences of Notch activity on ectopic Yki expression were assessed. When over-expressed in a stripe of cells along the A/P boundary, Yki was able to promote strong expression of ex-lacZ at the periphery of the wing pouch. Strikingly, the high levels of Yki were not able to force ex-lacZ expression at the D/V boundary where Notch activity is highest. These results suggest that the actions of Notch, ie ex-lacZ down-regulation, are epistatic to Yki. This was further verified when high levels of Yki were expressed together with high levels of Nicd. In this case, Nicd suppressed the ex-lacZ expression, demonstrating that it wins out over Yki in the wing pouch. However, at the periphery of the discs, Nicd was unable to modify the effects of Yki over-expression on ex-lacZ levels. Taken together these results suggest that Notch-mediated down-regulation of ex-lacZ occurs at the level or downstream of Yki (Djiane, 2014).

Since a major output of Notch pathway activity is the up-regulation of gene expression, whether any of the directly regulated Notch target-genes could be responsible for antagonizing Yki was assessed. Amongst the direct Notch targets identified in wing discs, several are predicted to encode transcriptional repressors. These include members of the HES family, E(spl)mβ, E(spl)m5, E(spl)m7, E(spl)m8 and Deadpan (dpn), as well as the homeodomain protein Cut. All of these proteins are normally expressed at high levels along the D/V boundary, in response to Notch activity, and hence are candidates to mediate the repression of ex-lacZ (Djiane, 2014).

Over-expression of E(spl)mβ, E(spl)m5 or E(spl)m7 repressors had no effect on ex-lacZ expression. In contrast, over-expression of either E(spl)m8 or of dpn resulted in a robust down-regulation of ex-lacZ. The effect differed slightly from that from Nicd expression, in that ex-lacZ expression was not completely abolished and low levels persisted throughout the wing pouch domain. These results indicate that a subset of the HES bHLH proteins have the capability to repress ex-lacZ, and hence are candidates to antagonize Yki. Previous experiments have demonstrated that the E(spl)bHLH genes and dpn have overlapping functions, especially at the D/V boundary. Therefore to determine whether these factors normally contribute to the repression of ex-lacZ, it was necessary to eliminate all of the E(spl)bHLH genes in combination with dpn. To achieve this a potent RNAi directed against dpn was expressed in MARCM clones that were homozygous mutant for a deficiency removing the entire E(spl) complex. No derepression of ex-lacZ was detectable in such clones, suggesting that none of the E(spl)bHLH/dpn genes can account for the repression of ex-lacZ at the D/V boundary or in the wing pouch. Therefore even though E(spl)m8 and dpn expression is sufficient for ex-lacZ repression, they do not appear to be essential in the context of the wing pouch (Djiane, 2014).

An alternative candidate was Cut, which encodes a transcriptional repressor and is expressed at the D/V boundary in response to Notch signaling. Similar to some of the HES genes, over-expression of Cut promoted a down-regulation of ex-lacZ. This was most clearly evident at early developmental stages because Cut induced a strong epithelial delamination at later stages, confounding the interpretation. However no up-regulation of ex-lacZ was detectable when Cut function was ablated, using RNAi, even though Cut levels where efficiently reduced. Thus, as with the HES genes, Cut is capable of inhibiting ex-lacZ expression but does not appear to be essential for the regulation of ex under normal conditions in the wing pouch (Djiane, 2014).

Recent studies have demonstrated that, in the absence of Yki, several SWH target genes are kept repressed by Sd, the DNA-binding partner of Yki. This so-called 'default repression' requires Tondu-domain-containing growth inhibitor (Tgi), an evolutionarily conserved tondu domain containing protein, which acts as a potent co-repressor with Sd. There is no evidence that Drosophila tgiM is a target of Notch in the wing disc, making it an unlikely candidate to mediate the inhibitory effects on Yki-mediated ex-lacZ expression. However, vg, which encodes another Sd binding-partner with a tondu domain, is directly regulated by Notch in the wing pouch. It was therefore hypothesized that Vg could mediate the effects of Notch on Yki function and ex-lacZ down-regulation (Djiane, 2014).

In agreement with the hypothesis, when Vg was over-expressed it strongly inhibited ex-lacZ expression in the pouch and promoted a modest overgrowth of the tissue. This overgrowth is somewhat puzzling since it appears that Yki activity, as monitored by ex-lacZ, is lowered in the presence of excess Vg. How over-expressed Vg triggers overgrowth remains poorly understood, but has been proposed to involve a cross-talk with the wg pathway. More recently, it has been shown that the expansion of the pouch region is achieved by Vg activating transiently and non-autonomously Yki in cells not expressing Vg. These cells are then recruited to become wing pouch cells and turn on vg expression. This model predicts a wave of Yki activation around Vg positive cells. Therefore, the overgrowth seen when Vg is over-expressed, could be due to a non-autonomous effect where more cells are recruited as pouch cells at the expense of more peripheral cells. Alternatively, Vg could promote proliferation of the pouch cells by an as yet unidentified mechanism, independent of Yki (Djiane, 2014).

Conversely to over-expressed Vg inhibiting ex-lacZ expression, lowering the levels of vg using RNA interference in the whole posterior compartment resulted in a significant up-regulation of ex-lacZ. Vg knock down has proven difficult to achieve in small populations of cells, due to their elimination from the wing pouch, probably by cell competition. Thus, unlike the other factors tested, Vg is required for the repression of ex-lacZ in the wing pouch. It was further shown that, co-expressing with NICD a vg RNAi transgene in the patched domain, suppresses the NICD mediated ex-lacZ repression in the wing pouch. Taken together, these results suggest that Vg mediates the repressive effects of Notch on expanded expression (Djiane, 2014).

If the involvement of Vg downstream of Notch is a general mechanism for cross-talk between Notch and Yki, other targets of the Sd-Yki complex should be inhibited by Notch in a similar manner to ex-lacZ. However, apart from expanded, all other known Yki targets in the wing pouch, such as thread/DIAP1, diminutive/myc, and Cyclin E are also direct Notch targets. Their final expression patterns are therefore a reflection of the balance between different transcriptional inputs, in particular Notch and Yki. A model predicts that Notch could have a dual effect on the expression of genes: a positive direct effect through the NICD/Su(H) complex when bound in their promoters, but also a negative effect through the induction of Vg, which prevents the positive effect of Yki on Sd bound promoters (Djiane, 2014).

In agreement with this model, thread/DIAP1 and diminutive/myc, two well established Yki targets in wing discs, which are normally refractory to Notch mediated activation in the centre of the pouch, become susceptible to Nicd when Vg or Sd levels are lowered through RNAi (Djiane, 2014).

Focusing on DIAP1, it was decided to separate the Notch and Yki direct inputs on transcription by isolating the Hippo pathway Responsive Elements (HREs) from any potential Notch Responsive Elements (NREs). IAP2B2C-lacZ is a previously described DIAP1-HRE driving lacZ reporter expression that does not contain any NRE, at least based on Su(H) ChIP data and bio-informatics prediction of Su(H) binding sites. The model predicts that this IAP2B2C-lacZ reporter should be inhibited by Vg. In control wing discs, it was confirmed that IAP2B2C-lacZ is expressed at uniform low levels with a slight increase at the periphery of the pouch, where Vg protein levels have been shown to fade. The D/V boundary expression of DIAP1 is not reported by IAP2B2C-lacZ confirming that the NRE is absent in this reporter (Djiane, 2014).

Vg levels were lowered using moderate RNAi knocked down in the whole posterior compartment using the hh-Gal4 driver. In this experimental set-up, the posterior compartment is smaller than normal, and vg knock-down induced a 12% up-regulation of IAP2B2C-lacZ expression when compared to IAP2B2C-lacZ levels in the anterior control compartment, demonstrating that Vg has a negative effect on this reporter activity (there was no difference in IAP2B2C-lacZ expression between the anterior and posterior compartment in the pouch region of control discs). It is noted that IAP2B2C-lacZ expression was up-regulated in a small stripe of cells in the anterior compartment just at the boundary with vg depleted cell. This region was excluded from the quantifications, but suggests that the IAP2B2C-lacZ reporter fragment could be sensitive to a non-autonomous input acting around the boundary of cells with different Vg levels (Djiane, 2014).

It appears therefore, that at least for the two Yki targets ex-lacZ and IAP2B2C-lacZ, Vg inhibits their expression in the wing pouch. Previous studies reported independent roles of Vg and Yki on the activation of their targets, and could appear to contradict this newly described inhibitory role of Vg on Yki targets. However, in these previous studies, it was demonstrated that Vg and Yki do not require each other to promote wing pouch cell survival and to activate their respective targets, which does not rule out any negative cross regulation, as shown in this report (Djiane, 2014).

This analysis brings therefore new evidence of the central role of Vg in the complex network regulating wing disc growth, adding a new level of complexity in its interaction with the SWH pathway effector Yki. Thus, Notch induced expression of Vg could give rise to an Sd-Vg repressive complex that prevents expression of Yki targets. In situations where SWH signaling is lowest, Yki levels may be sufficiently high to overcome this repression. This suggests that in the wing pouch, Notch and SWH would act co-operatively rather than antagonistically (Djiane, 2014).

Outside of the pouch, at the wing disc periphery, sd and vg expressions are not promoted by Notch activity. Furthermore, other binding partners for Yki, such as Homothorax are expressed there and might substitute for Sd to control the expression of Yki targets in a way similar to what has been described in the Drosophila eye. The differential expression of these transcription factors in the disc could explain why Notch only has an inhibitory effect on Yki targets in the wing pouch. Furthermore, it is also worth noting that Notch has very different effect outside of the pouch, where it promotes Yki stabilization non-autonomously via its regulation of ligands for the Jak/Stat pathway (Djiane, 2014).

In summary, the evidence demonstrates that Notch activity can inhibit Yki under circumstances where Yki acts together with Sd. It does so by promoting the expression of Vg, a co-factor for Sd, counteracting the effects of Yki. This cross talk potentially extends to mammalian systems as the active form of NOTCH1, NICD1 promotes the up-regulation of VGLL3 (a human homologue of vg) in MCF-10A breast cancer derived cells. Thus, similar mechanisms may also be important in mediating interactions between the NOTCH and SWH pathways in human diseases (Djiane, 2014).

Because the end-point of SWH pathway activity is to prevent Yki function, the inhibitory effects of Notch on Yki could provide an explanation for those cellular contexts where the two pathways act co-operatively, as at the D/V boundary in the wing discs. Similar co-operative effects have been noted in the Drosophila follicle cells. However, in this case it is the SWH activity that is involved in promoting the expression of Notch targets. In other contexts, such as the mouse intestine, accumulation of Yap1, the mouse Yki homolog, and therefore inhibition of the SWH promotes Notch activity. These examples demonstrate that the interactions between Notch and the SWH are highly dependent on cellular context. The results suggest that some of these differences may be explained by the nature of the target genes that are regulated and by which Yki co-operating transcription factors are present in the receiving cells (Djiane, 2014).

REFERENCES

Babaoglan, A. B., Housden, B. E., Furriols, M. and Bray, S. J. (2013). Deadpan contributes to the robustness of the Notch response. PLoS One 8: e75632. PubMed ID: 24086596

Badenhorst, P. (2001). Tramtrack controls glial number and identity in the Drosophila embryonic CNS. Development 128: 4093-4101. PubMed ID: 11641231

Barbash, D. A. and Cline, T. W. (1995). Genetic and molecular analysis of the autosomal component of the primary sex determination signal of Drosophila melanogaster. Genetics 141(4): 1451-71. PubMed ID: 8601486

Bello, B. C., Izergina, N., Caussinus, E. and Reichert. H. (2008). Amplification of neural stem cell proliferation by intermediate progenitor cells in Drosophila brain development. Neural Dev. 3: 5. PubMed ID: 18284664

Bier, E., Vassin, H., Younger-Shepherd, S., Jan, L.Y. and Jan, Y.N. (1992). deadpan, an essential pan-neural gene in Drosophila, encodes a helix-loop-helix protein similar to the hairy gene product. Genes Dev. 6: 2137-2151. PubMed ID: 1427077

Boone, J. Q. and Doe, C. Q. (2008). Identification of Drosophila type II neuroblast lineages containing transit amplifying ganglion mother cells. Dev Neurobiol. 68(9): 1185-1195. PubMed ID: 18548484

Bowman, S. K., Rolland, V., Betschinger, J., Kinsey, K. A., Emery, G. and Knoblich, J. A. (2008). The tumor suppressors Brat and Numb regulate transit-amplifying neuroblast lineages in Drosophila. Dev Cell 14: 535-546. PubMed ID: 18342578

Brody, T., Rasband, W., Baler, K., Kuzin, A., Kundu, M. and Odenwald, W. F. (2008). Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers. BMC Genomics 9: 371. PubMed ID: 18673565

Canon, J. and Banerjee, U. (2003). In vivo analysis of a developmental circuit for direct transcriptional activation and repression in the same cell by a Runx protein. Genes Dev. 17: 838-843. PubMed ID: 12670867

Choksi, S. P., Southall, T. D., Bossing, T., Edoff, K., de Wit, E., Fischer, B. E., van Steensel, B., Micklem, G. and Brand, A. H. (2006). Prospero acts as a binary switch between self-renewal and differentiation in Drosophila neural stem cells. Dev. Cell 11: 775-789. PubMed ID: 17141154

Dawson, S. R., et al. (1995). Specificity for the hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression. Mol Cell Biol 15: 6923-6931. PubMed ID: 8524259

Djiane, A., Zaessinger, S., Babaoglan, A. B., Bray, S. J. (2014). Notch inhibits yorkie activity in Drosophila wing discs. PLoS One 9: e106211. PubMed ID: 25157415

Emery, J.F. and Bier, E. (1995). Specificity of CNS and PNS regulatory subelements comprising pan-neural enhancers of the deadpan and scratch genes is achieved by repression. Development 121: 3549-3560. PubMed ID: 8582269

Hoshijima, K., et al. (1995). Transcriptional regulation of the Sex-lethal gene by helix-loop-helix proteins. Nucleic Acids Res 23: 3441-3448. PubMed ID: 7567454

Janssens, D. H., Hamm, D. C., Anhezini, L., Xiao, Q., Siller, K. H., Siegrist, S. E., Harrison, M. M. and Lee, C. Y. (2017). An Hdac1/Rpd3-poised circuit balances continual self-renewal and rapid restriction of developmental potential during asymmetric stem dell division. Dev Cell 40(4): 367-380 e367. PubMed ID: 28245922

Karandikar, U., Trott, R. L., Yin, J., Bishop, C. P. and Bidwai, A. P. (2004). Drosophila CK2 regulates eye morphogenesis via phosphorylation of E(spl)M8. Mech. Dev. 121: 273-286. PubMed ID: 15003630

Karandikar, U. C., Shaffer, J. Bishop, C. P. and Bidwai, A. P. (2005). Drosophila CK2 phosphorylates Deadpan, a member of the HES family of basic-helix-loop-helix (bHLH) repressors. Molec. Cell. Biochem. 274: 133-139. PubMed ID: 16342413

Li, X., Chen, R. and Zhu, S. (2017). bHLH-O proteins balance the self-renewal and differentiation of Drosophila neural stem cells by regulating Earmuff expression. Dev Biol [Epub ahead of print]. PubMed ID: 28899667

Li, Z., Guo, X., Huang, H., Wang, C., Yang, F., Zhang, Y., Wang, J., Han, L., Jin, Z., Cai, T. and Xi, R. (2020). A switch in tissue stem cell identity causes neuroendocrine tumors in Drosophila gut. Cell Rep 30(6): 1724-1734. PubMed ID: 32049006

Parrish, J. Z., Kim, M. D., Jan, L. Y. and Jan, Y. N. (2006). Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites. Genes Dev. 20(7): 820-35. PubMed ID: 16547170

Roark, M., et al. (1995). scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development. GenesDev. 9: 2384-98. PubMed ID: 7557390

Rosenberg, M. I. and Parkhurst, S. M. (2002). Drosophila Sir2 is required for heterochromatic silencing and by euchromatic Hairy/E(Spl) bHLH repressors in segmentation and sex determination. Cell 109: 447-458. PubMed ID: 12086602

San-Juán, B. P. and Baonza, A. (2011). The bHLH factor deadpan is a direct target of Notch signaling and regulates neuroblast self-renewal in Drosophila. Dev. Biol. 352(1): 70-82. PubMed ID: 21262215

San Juan, B. P., Andrade-Zapata, I. and Baonza, A. (2012). The bHLH factors Dpn and members of the E(spl) complex mediate the function of Notch signalling regulating cell proliferation during wing disc development. Biol Open 1: 667-676. PubMed ID: 23213460

Southall, T. D. and Brand, A. H. (2009). Neural stem cell transcriptional networks highlight genes essential for nervous system development. EMBO J. 28(24): 3799-807. PubMed ID: 19851284

Trott, R. L., Kalive, M., Paroush, Z. and Bidwai, A. P (2001). Drosophila melanogaster casein kinase II interacts with and phosphorylates the basic-helix-loop helix (bHLH) proteins m5, m7, and m8 derived from the Enhancer of split complex. J. Biol. Chem. 276: 2159-2167. PubMed ID: 11208814

Wallace, K., Liu, T. H. and Vaessin, H. (2000). The pan-neural bHLH proteins DEADPAN and ASENSE regulate mitotic activity and cdk inhibitor dacapo expression in the Drosophila larval optic lobes. Genesis 26(1): 77-85. PubMed ID: 10660675

Winston, R. L., et al. (1999). Characterization of the DNA binding properties of the bHLH domain of Deadpan to single and tandem sites. Biochemistry 38(16): 5138-46. PubMed ID: 10213619

Winston, R. L. and Gottesfeld, J. M. (2000). Rapid identification of key amino-acid-DNA contacts through combinatorial peptide synthesis. Chem. Biol. 7(4): 245-51. PubMed ID: 10780928

Younger-Shepherd, S., Vassin, H., Bier, E., Jan, L.Y. and Jan, Y.N. (1992). deadpan, an essential pan-neural gene encoding an HLH protein, acts as a denominator in Drosophila sex determination Cell 70: 911-922. PubMed ID: 1525829

Zacharioudaki, E., Magadi, S. S. and Delidakis, C. (2012) bHLH-O proteins are crucial for Drosophila neuroblast self-renewal and mediate Notch-induced overproliferation. Development 139: 1258-1269. PubMed ID: 22357926

Zhu, S., et al. (2012). The bHLH repressor Deadpan regulates the self-renewal and specification of Drosophila larval neural stem cells independently of Notch. PLoS One 7(10): e46724. PubMed ID: 23056424

Date revised: 15 August 2020

The Interactive Fly resides on the
Society for Developmental Biology's Web server.