InteractiveFly: GeneBrief

nervous fingers 1 : Biological Overview | Regulation | Developmental Biology | Effects of Mutation | Evolutionary Homologs | References

BIOLOGICAL OVERVIEW

Nerfin-1 is a nuclear regulator of axon guidance required for a subset of early pathfinding events in the developing Drosophila CNS. Nerfin-1 belongs to a highly conserved subfamily of Zn-finger proteins with cognates identified in nematodes and man. The neural precursor gene prospero is essential for nerfin-1 expression. Unlike nerfin-1 mRNA, which is expressed in many neural precursor cells, the encoded Nerfin-1 protein is only detected in the nuclei of neuronal precursors that will divide just once and then transiently in their nascent neurons. Although nerfin-1 null embryos have no discernible alterations in neural lineage development or in neuronal or glial identities, CNS pioneering neurons require nerfin-1 function for early axon guidance decisions. Furthermore, nerfin-1 is required for the proper development of commissural and connective axon fascicles. Nerfin-1 is essential for the proper expression of robo2, wnt5, derailed, G-oα47A, Lar, and futsch, genes whose encoded proteins participate in these early navigational events (Kuzin, 2005).

Initially discovered in a screen for neural precursor genes, nerfin-1 encodes a member of a subfamily of Zn-finger proteins with cognates identified in all metazoans (Brody, 2002a; Stivers, 2000). Nerfin-1 and other family members contain a highly conserved set of tandem Zn-fingers termed the EIN domain [named after the first three identified members: nematode egg laying-46 mutant (egl-46) (Desai, 1989; Desai, 1988); human insulinoma associated-1, IA-1 (Goto, 1992); and Drosophila nerfin-1 (Stivers, 2000). Loss of egl-46 function causes multiple defects in C. elegans nervous system development including abnormalities in cell migration, axonal outgrowth, and neurotransmitter production (Wu, 2001; Yu, 2003). The mammalian IA-1, shown to be a sequence-specific DNA binding protein (Breslin, 2002), is expressed during CNS development and in neuroendocrine tumors (Breslin, 2003; Kuzin, 2005 and references therein).

Although nerfin-1^null mutant embryos have no discernible alteration in either CNS or PNS lineage development, loss of nerfin-1 triggers axonal patterning defects throughout the CNS, but not in the PNS. These studies demonstrate that Nerfin-1 is required for the proper expression of a subset of factors that participate in early axon guidance decisions essential to both commissural and longitudinal connective axon fascicle development. Analysis of nerfin-1 expression reveals that Nerfin-1 protein is detected in only a subset of neural precursor cells that express its encoding message. Nerfin-1 accumulates in the nuclei of only those precursor cells that divide just once producing neurons and is then transiently expressed in their nascent offspring. Prolonged expression of Nerfin-1 in neurons interferes with later stages of CNS axon fasciculation and patterning. Finally, nerfin-1 is shown to be downstream of pros in the regulatory network(s) controlling axon guidance determinants. Epistasis experiments also demonstrate that the regulatory networks controlling nerfin-1 expression and those regulating the expression of lola or fru are separate from one another (Kuzin, 2005).

Although nerfin-1 mRNA expression is first detected in all early delaminating NBs, its encoded protein is detected only in NBs, specifically the MPs, which divide just once to produce interneurons. The transient expression of nerfin-1 mRNA in NBs, during the early phases of lineage development but not during intermediate or late stages, suggests that its NB expression is subject to temporal regulation (reviewed by Brody, 2002b). Following this initial phase of expression, nerfin-1 mRNA is detected in most if not all GMCs and nascent neurons and, again, Nerfin-1 protein is detected only transiently in a subset of these cells. Nerfin-1 protein is also transiently expressed in nascent PNS neurons. The transient expression of Nerfin-1 in neurons during the initial phases of axon development is consistent with the idea that it may be required for specific aspects of early axon guidance, particularly in CNS interneurons. In addition, the absence of detectable Nerfin-1 protein in many mRNA expressing cells suggests that its message may be translationally blocked and/or that the protein is rapidly degraded in these cells. A recent genome-wide screen for genes whose transcripts contain potential binding sites for the translational blocking micro-RNAs (miRNAs) has revealed that the 3′ UTR of the nerfin-1 message (1600 bases long) contains multiple predicted docking sites for nine different miRNAs (Enright, 2003). Protein instability motifs (PEST sites) within Nerfin-1 may also play a role in rapidly clearing Nerfin-1 from cells (Kuzin, 2005).

Although no cross-regulation was detected between nerfin-1 and lola or fruitless, pros is required for full nerfin-1 expression. In addition to its role in axon guidance, pros has been shown to be required to bring precursor cells out of the proliferative state as a prelude to neuronal proliferative quiescence. Absence of pros results in an additional division of the GMC that results in increased numbers of cells in the CNS. In nerfin-1^null embryos, no evidence was found to indicate that loss of nerfin-1 affects precursor or neuron cell numbers nor does it trigger an increase in cell death, suggesting that nerfin-1 carries out a restricted repertoire of the pros functions, specifically those involved with axon guidance (Kuzin, 2005).

Analysis of nerfin-1^null embryos indicates that Nerfin-1 is needed by many, but not all, CNS neurons during the early phases of axon patterning. For example, while the development and patterning of ventral cord longitudinal connective fascicles is disrupted and both anterior and posterior commissure development is compromised, no significant disruptions are detected in motoneuron nerve tracks that exit the CNS, nor are significant disruptions detected in the PNS axon patterning (Kuzin, 2005).

It is likely that many of the subsequent defects in axon guidance, related to crossing segmental boundaries, defasciculation, and/or commissural development may have their origins in defects in the initial guidance decisions made by pioneering axons. Disruption in the initial pathfinding events can trigger subsequent misguidance of 'follower neurons' that rely on guidance cues laid down by pioneers. The pCC axon misguidance in nerfin-1 mutants could explain, in part, why many other axons fail to extend across the segmental border in nerfin-1mutants. Two aspects of pCC axon guidance are altered in nerfin-1 mutants: (1) the pCC interneuron fails to extend its axon in the proper anterior orientation and, (2) many of the misguided axons cross the midline in adjacent posterior segments. During normal development, the pCC ipsilateral axon pioneers the innermost longitudinal fascicle, the medial fascicle, and other axons project along the tract established by the pCC. Although defects in the initial anterior/posterior direction of pCC axon projection have not been reported in other mutant backgrounds, abnormal crossing of the midline has been observed in eve mutants (Fujioka, 2003) and also observed in robo mutant embryos; axons that normally pioneer ipsilateral projections project anteriorly and then cross the midline, and contralaterally projecting axons re-cross the midline multiple times. At this time, it is not known whether the follower axons also are defective in navigation, or whether their misguidance is solely due to initial axon pathfinding mistakes made by the pioneering neurons. Given the large numbers of neurons that express Nerfin-1, a scenario that includes both possibilities is favored (Kuzin, 2005).

Analysis of the expression dynamics of known axon guidance genes in nerfin-1^null embryos has revealed that nerfin-1 function is required for the proper expression of a subset of factors involved in at least two signaling events essential for early CNS axon patterning. Although Netrin/Frazzled signaling appears not to be affected by loss of nerfin-1, nerfin-1 function is required for the proper expression of specific genes involved in the decision to cross the midline and in the choice of commissures. One of the components of the Slit/Robo system, Robo2, requires Nerfin-1, either directly or indirectly, for full expression. Interestingly, altered expression of the other factors involved in the Slit/Robo pathway was not detected, specifically slit, comm, comm3, robo, and robo3 appear unaffected in nerfin-1^null embryos. Robo2 expression is restricted to axons that extend in the outer longitudinal pathway (the lateral fascicle), farthest from the midline and thus farthest from the source of Slit. The robo2 loss-of-function phenotype does not resemble that of the nerfin-1^null, suggesting that only a part of the nerfin-1 loss-of-function phenotype can be derived from its regulation of robo2 (Kuzin, 2005).

nerfin-1 function is also required for the proper expression of Drl and Wnt5, two factors involved in the choice between entering the AC or PC. Both derailed and Wnt5 mutants display abnormal projections of AC axons. Although not as severe as in nerfin-1^null embryos, the loss of Wnt5 also triggers breaks in longitudinal connectives, specifically the intermediate and lateral fascicles (Kuzin, 2005).

Delayed onset of futsch expression was observed in nerfin-1^null embryos. In loss-of-function futsch mutant alleles, the development of the lateral-most longitudinal connectives is reduced. Some of the axon fasciculation defects seen in nerfin-1^null embryos could be explained in part by delayed futsch expression, especially those exhibited by pioneering axons that make up the lateral fascicle (Kuzin, 2005).

Reduced expression of G-oα47A and Lar were also observed. G-oα47A is required for the proper development of Fas2-positive connectives. However, the axon guidance phenotype of G-oα47A mutants is more severe than in nerfin-1^null embryos; in the G-oα47A mutant: AC and PC do not separate. The greater severity in the G-oα47A mutant could be explained by the fact that loss of nerfin-1 does not completely ablate G-oα47A expression. Lar has been found to regulate motoneuron axon guidance decisions outside of the CNS. The lack of motoneuron axon patterning defects in nerfin-1^null embryos could be explained by the fact that Lar expression, in mutants, was just reduced and not ablated (Kuzin, 2005).

Although some of the axon guidance defects in the nerfin-1^null mutants can be explained, in part, as a result of the altered expression of the above genes, certain aspects of the patterning defects are distinct from those described for these genes. For example, patterning defects in pCC axons have been observed due to loss of eve or robo, but the reversed anterior/posterior orientation of many of the pioneering pCC axons in nerfin-1^null embryos has not been seen in other mutant backgrounds. This suggests that Nerfin-1 may regulate additional, as yet uncharacterized pathfinding determinants. Therefore, it will be very interesting to identify additional genes regulated by Nerfin-1 since these are very likely to include new members of the axon guidance machinery (Kuzin, 2005).

Function of Nerfin-1 in preventing medulla neurons dedifferentiation requires its inhibition of Notch activity

Drosophila larval central nervous system comprises the central brain, ventral nerve cord and optic lobe. In these regions, neuroblasts divide asymmetrically to self-renew and generate differentiated neurons or glia. To date, mechanisms of preventing neuron dedifferentiation are still unclear, especially in the optic lobe. This study shows that the zinc finger transcription factor Nerfin-1 is expressed in early stage of medulla neurons and essential for maintaining their differentiation. Loss of Nerfin-1 activates Notch signaling, which promotes neuron-to-NB reversion. Repressing Notch signaling largely rescues dedifferentiation in nerfin-1 mutant clones. Thus, it is concluded that Nerfin-1 represses Notch activity in medulla neurons and prevents them from dedifferentiation (Xu, 2017).

Stem cells generate progeny that undergo terminal differentiation. In Drosophila CNS, the balance of self-renewal and differentiation of neural stem and progenitor cells is a central issue during development. On the other hand, the maintenance of differentiated status of post-mitotic neurons is also crucial for tissue function and homeostasis. It is obvious that mechanisms must exist to prevent the cells from dedifferentiation. Although proteins that function to keep differentiation have been well studied in other cell types, few have been implicated in post-mitotic neuronal maintenance. In the central brain, loss of Midlife crisis (Mdlc), a CCCH zinc-finger protein, results in a decrease in Pros, thus derepressing NB genes in neurons. However, it is insufficient to make neurons revert to proliferating NBs. Furthermore, as Pros is not expressed in medulla neurons, it is unclear whether Mdlc has the same function in the optic lobe. On the other hand, absence of Lola leads to neuron-to-NB reversion and tumorigenesis , but it is crucial for neuronal maintenance only in the optic lobe. Recently, a paper reported that Nerfin-1 loss induces neuron dedifferentiation in both central brain and VNC (Froldi, 2015). This paper demonstrates a conserved function for Nerfin-1 in medulla neurons in the optic lobe. These findings indicate that Nerfin-1 is expressed mainly in early-stage medulla neurons and functions to maintain their differentiated state (Xu, 2017).

Interestingly, it was noticed that ectopic NB induced by Nerfin-1 depletion in the optic lobe appeared much earlier than that in the central brain. Considering that Lola loss causes dedifferentiation just in the optic lobe, it is speculated that the differentiated state of medulla neurons is less stable, possibly owing to absence of Pros. Furthermore, different from the mechanism in the central brain, the function of Nerfin-1 in the optic lobe requires the silencing of Notch signaling. Neither Myc knockdown nor Tor-DN misexpression inhibits dedifferentiation caused by Nerfin-1 loss in the medulla neurons. Thus, these findings identify a distinct regulatory mechanism in medulla neurons and validate different regulatory modes between the optic lobe and the rest of the CNS (Xu, 2017).

On the other hand, cell cycle genes play important roles in cell differentiation. Among them, Cyclin E (CycE) is reported to be regulated directly by Lola-N and is involved in the neuron dedifferentiation caused by loss of Mdlc. Thus, this study also examined whether CycE is regulated directly by Nerfin-1 and controls cell differentiation independently of Notch and neuroblast genes. Interestingly, CycE expression levels were upregulated dramatically in nerfin^-1159 clones, but such upregulation was mostly blocked by Notch repression. These results suggest that CycE is not a direct target of Nerfin-1 for maintaining medulla neuron differentiation. CycE acts downstream of Notch signaling or it is subsequently upregulated after cell type change (Xu, 2017).

As Notch signaling is hyper-activated in nerfin-1 mutant clones, it was of interest to discover how it is regulated. One possibility is that Notch signaling becomes constitutively activated without the inhibition by Nerfin-1. To investigate this, Delta was knocked down upon Nerfin-1 loss and it was found that dedifferentiation was suppressed. These results indicate that Notch signaling is not constitutively activated and that it needs a ligand. Furthermore, Notch signal is both produced and received by medulla neurons. At the same time, the results show that Nerfin-1 loss induces dramatic upregulation of the expression level of Notch receptor. Thus, it is hypothesized that Nerfin-1 suppresses the expression of the Notch receptor in normal medulla neurons and inhibits Notch pathway activity. When Nerfin-1 is absent, expression levels of the Notch receptor increase strikingly. The receptors then bind to Delta from the adjacent cells and activate Notch signaling in its own. However, it is still unclear whether Notch receptor is a direct target of Nerfin-1. Therefore, subsequent studies on Nerfin-1 may help to clarify the underlying mechanisms and provide better understanding about neuronal maintenance (Xu, 2017).

The Scalloped and Nerfin-1 transcription factors cooperate to maintain neuronal cell fate

The ability of cells to stably maintain their fate is governed by specific transcription regulators. This study shows that the Scalloped (Sd) and Nervous fingers-1 (Nerfin-1) transcription factors physically and functionally interact to maintain medulla neuron fate in the Drosophila melanogaster CNS. Using Targeted DamID, Sd and Nerfin-1 were found to occupy a highly overlapping set of target genes, including regulators of neural stem cell and neuron fate, and signaling pathways that regulate CNS development such as Notch and Hippo. Modulation of either Sd or Nerfin-1 activity causes medulla neurons to dedifferentiate to a stem cell-like state, and this is mediated at least in part by Notch pathway deregulation. Intriguingly, orthologs of Sd and Nerfin-1 have also been implicated in control of neuronal cell fate decisions in both worms and mammals. These data indicate that this transcription factor pair exhibits remarkable biochemical and functional conservation across metazoans (Vissers, 2018).

When cells differentiate, they must maintain their fate in a stable manner and repress their ability to adopt alternate cell fates. This is essential for the function of differentiated cells and, when aberrant, can result in pathological consequences. The mechanism by which neuronal cell fate is stably maintained is incompletely understood, with only a handful of factors being linked to this process. This study demonstrates that Nerfin-1 maintains the fate of medulla neurons in the optic lobes of the D. melanogaster CNS, in partnership with the TEA domain transcription factor Sd. The data are consistent with the idea that these proteins operate as a transcription factor pair, given that they form a physical complex, and bind to a highly overlapping set of genomic loci. Putative Sd/Nerfin-1 targets were enriched for genes that are functionally associated with the fate of neurons and neuroblasts, cellular metabolism, as well as developmental signaling pathways such as Notch and Hippo. Given that forced activation of Sd target genes induced reversion of medulla neurons to neural stem cells (NSCs), it is hypothesized that aberrant activation of genes that Sd and Nerfin-1 regulate, is the primary driver of neuronal dedifferentiation in their absence (Vissers, 2018).

The Notch pathway was identified as a key target for regulation by Nerfin-1 and Sd, because (1) expression of multiple Notch pathway members was elevated when either Sd or Nerfin-1 function was perturbed; (2) Notch activity was required for dedifferentiation caused by Sd or Nerfin-1 deregulation; and (3) expression of a hyperactive Notch transgene was sufficient to induce dedifferentiation of medulla neurons. Recently, a requirement of Nerfin-1 has been identified in maintaining the differentiated status of neurons in the ventral nerve cord, central brain, and medulla lineages (Froldi, 2015, Xu, 2017). The latter study also demonstrated a requirement for Notch hyperactivity in mediating medulla neuron dedifferentiation following nerfin-1 loss. The current study extend these studies by showing that Nerfin-1 regulates neuronal maintenance in partnership with Sd. Furthermore, this study demonstrates that these transcription factors promote neuronal fate by regulating the expression of multiple Notch pathway genes (Vissers, 2018).

These data further demonstrate that neuronal cell fate is maintained by distinct factors in different regions of the CNS. In contrast to Nerfin-1, which is required to maintain neuronal differentiation in several neuroblast lineages, Sd is specifically required to maintain the fate of medulla neurons but not neurons derived from ventral nerve cord or central brain neuroblast lineages. The CNS region-specific function of Sd, versus the general requirement for Nerfin-1, is reminiscent of that described for Lola and Prospero, where Lola is required to maintain medulla neuronal fate, but acts redundantly with Prospero in other regions of the CNS. Future studies will elucidate the cooperative transcriptional networks that govern neuronal fate maintenance in different regions of the CNS (Vissers, 2018).

Sd function has been best studied in the context of Hippo pathway-dependent tissue growth, where it serves as the key transcription factor of the Yki transcriptional co-activator. Sd has also been linked to regulation of transcription with other proteins, such as Vestigial, Tondu-domain-containing Growth Inhibitor (Tgi), and in this study, Nerfin-1. Interestingly, the Hippo pathway was among the top signaling pathways identified in KEGG analyses on putative Sd/Nerfin-1 target genes. However, Sd promotes medulla neuronal fate independent of Hippo and Yki, as Yki is not obviously expressed in medulla neurons and cannot induce dedifferentiation. Interestingly, this contrasts with the reported role of Hippo, Yki, and Sd in other neurons. For example, these proteins operate together to control the fate of R8 photoreceptor neurons of the D. melanogaster eye. In one class of these light-sensing neurons, Yki and Sd are required to adopt a fate that allows the sensing of blue light, whereas in the other subtype, which senses green light, the Hippo pathway represses Yki and Sd activity (Vissers, 2018).

Orthologs of Sd and Nerfin-1 have been functionally linked in both C. elegans and vertebrates. In C. elegans, EGL-44 and EGL-46 form a physical complex and are both required to specify neuronal cell fate and Q neuroblast differentiation. By characterizing both the biochemical interaction of Sd and Nerfin-1 and their role in maintenance of neuronal fate, this study shows that they cooperate to perform similar functions in flies and worms. The vertebrate orthologs of Sd and Nerfin-1 (TEAD1-4 and INSM1) have also been implicated in various aspects of neural and neuroendocrine development. Murine INSM1 is required for the development of endocrine and neuroendocrine cells of the pancreas, intestine, pituitary, and lung, while in the CNS, it is required for differentiation of neural progenitor cells. Furthermore, zebrafish insm1a has been implicated in dedifferentiation in the context of Müller glia regeneration. Similarly, expression of a TEAD gain-of-function allele caused a marked expansion of the neural progenitor pool in the developing chick neural tube. Interestingly, preliminary studies suggest that the TEAD/INSMI pair might also operate together in vertebrates; a motif corresponding to the TEAD binding site was enriched in INSM1 target genes, as determined by INSM1 ChIP-seq performed in murine pancreatic beta cells. These studies of Sd and Nerfin-1 in the Drosophila CNS, coupled with the finding that human TEAD1 and INSM1 form a physical complex, further strengthen the idea that these proteins represent an evolutionarily conserved transcription factor pair (Vissers, 2018).

A comprehensive temporal patterning gene network in Drosophila medulla neuroblasts revealed by single-cell RNA sequencing

During development, neural progenitors are temporally patterned to sequentially generate a variety of neural types. In Drosophila neural progenitors called neuroblasts, temporal patterning is regulated by cascades of Temporal Transcription Factors (TTFs). However, known TTFs were mostly identified through candidate approaches and may not be complete. In addition, many fundamental questions remain concerning the TTF cascade initiation, progression, and termination. This work used single-cell RNA sequencing of Drosophila medulla neuroblasts of all ages to identify a list of previously unknown TTFs, and experimentally characterize their roles in temporal patterning and neuronal specification. This study reveals a comprehensive temporal gene network that patterns medulla neuroblasts from start to end. Furthermore, the speed of the cascade progression is regulated by Lola transcription factors expressed in all medulla neuroblasts. This comprehensive study of the medulla neuroblast temporal cascade illustrates mechanisms that may be conserved in the temporal patterning of neural progenitors (Zhu, 2022).

scRNA-Seq analysis revealed the temporal progression of transcriptional profiles as medulla NBs age at single-cell resolution. Candidates of critical temporal patterning regulators included eight previously unknown TTFs, as well as TFs such as Nerfin-1 and Lola, that are also involved in the temporal patterning process. Further experimental validation of previously unknown TTFs and other crucial regulators confirmed the accuracy of the high-resolution data, supporting that scRNA-seq is a powerful tool to study the highly dynamic temporal patterning process. This analysis and further experimental investigation revealed a comprehensive temporal cascade in Drosophila medulla NBs: Hth+SoxN+dmrt99B->Opa->Ey+Erm->Ey+Opa->Slp+Scro->D->BarH1&2->Tll, Gcm (see A schematic model summarizing the medulla TTF cascade and its regulation), and also illustrated several principles that are likely conserved during the temporal patterning of neural progenitors (Zhu, 2022).

First, this study identified early temporal factors that initiate the medulla neuroblast TTF cascade. Before this study, Hth was proposed to be the only TTF at play during the earliest temporal stage. Hth is expressed in the neuroepithelium and the youngest NBs. It is necessary for the generation of Bsh neurons, but is required neither for the NE to NB transition nor for the further temporal cascade progression. Loss of Ey also does not affect the termination of Hth. These data suggested missing links between Hth and the later TTF cascade. Several previously unknown TTFs were identified that linked the whole cascade together. Two of those TTFs that start their expression in the NE, SoxN, and Dmrt99B, are also required for the first temporal fate (Bsh neurons), and Dmrt99B is required for the timely activation of Opa in the youngest NBs. Opa is then required to activate Ey and repress Hth. Interestingly, the three TTFs inherited from NE maintain their expression for different durations in NBs, as Hth is repressed by Opa and Erm, SoxN is repressed by Ey, whereas Dmrt99B expression extends until the Slp stage. Whether this differential downregulation is significant for temporal patterning is currently unknown. However, it is worth noting that the expression of mammalian orthologs of Dmrt99B, Dmrt3, and Dmrta1, also starts in symmetrically dividing early cortical progenitors (NE), and decreases gradually in asymmetrical dividing cortical progenitors due to the direct suppression by FoxG1, the mammalian ortholog of Slp1/2. Given the essential role of Dmrt99B in initiating temporal patterning in medulla neuroblast, it will be interesting to investigate whether its mammalian orthologs play conserved roles in the temporal patterning of cortical progenitors (Zhu, 2022).

Second, this study showed that a broad temporal stage can be divided into sub-temporal stages by combinations of TTFs, which determine the progeny fates. This is well-illustrated in the Ey stage. The first stripe of Opa is necessary to initiate the expression of Erm and Ey, which are then required to repress Opa in a negative feedback loop, generating a gap in Opa expression. Furthermore, the data suggest that Ey may first enhance the activation of Erm at the gap, but then possibly a higher level of Ey is required to repress Erm, either directly or indirectly. After Erm is turned off, Opa is turned back on. At the same time, Slp has been gradually activated by Ey and Scro, and when it reaches a certain level, it will repress Opa and Ey to end the Ey stage. Thus, cross-regulations among TTFs divide the Ey stage into (at least) two (sub-)temporal stages determined by the co-expression of Ey and Erm, or Ey and Opa. Different neural types are generated in these two sub-temporal stages, and the first set of neurons require both Ey and Erm, whereas the second set of neurons require both Ey and Opa. Interestingly to note, the mammalian ortholog of Erm, Fezf2, is also expressed in cortical progenitors and plays important roles in cortical neuron specification (Zhu, 2022).

Third, this study demonstrated that a TTF that is required for the switch to gliogenesis at the final stage is also required for the cell-cycle exit and termination of the medulla TTF cascade. Previously it was thought that Tll stage NBs switch to gliogenesis and then exit the cell cycle, but whether Tll indeed plays a role in these processes has not been studied. Here, the scRNA-Seq data suggested another final temporal stage marked by the expression of Gcm and Dap. Further, it was shown that BarH1 and BarH2 are required to activate both Tll and Gcm, but Tll is activated first, and when Gcm is activated, Gcm represses Tll. Gcm but not Tll is required for the NBs to switch to gliogenesis and exit the cell cycle. Gcm is well-known for its role in gliogenesis, but this study showed that it is also required and sufficient to activate Dap expression in NBs, possibly through which to promote cell-cycle exit and end the temporal progression. In vertebrate retina, scRNA-seq analysis of retinal progenitor cells identified NFI factors as required for both late-born cell fates including Muller glia and for exiting the cell cycle. As neural progenitors often switch to produce glia at the end of the lineage, it is possibly a general mechanism that factors required for the switch to gliogenesis are also required for the mitotic exit to end the temporal progression (Zhu, 2022).

Another factor that is likely involved in the final stage is Nerfin-1. The expression of Nerfin-1 is observable mostly in maturing neurons, and is required to prevent neurons from de-differentiation. However, this TF responsible for maintaining the differentiation status of neurons, is turned on in the final-stage NBs, where it may function to promote gliogenesis and help terminate the temporal cascade on time. The fast exit of the cell cycle at the final stage is likely accomplished because self-renewal repressors that usually function in GMCs and neurons, such as Prospero and Nerfin-1, gather and cooperate in the oldest NBs. Whether Nerfin-1 can be characterized as a TTF is a remaining question. Since Nerfin-1 expression in both the oldest NBs and the newly born glia is very transient, and cell cycle exit is coupled with glia generation in the oldest NBs, it is not easy to distinguish when exactly Nerfin-1 functions to contribute to the termination of the final temporal stage. The mechanism behind Nerfin-1's requirement at the final stage may be different from the mechanism used in neurons preventing their de-differentiation. One evidence is that while a previous study showed that double knockdown of Nerfin-1 and Su(H) could reduce most ectopic NBs generated by single knockdown of Nerfin-1, suggesting that Nerfin-1 represses Notch signaling in neurons to prevent their de-differentiation, there are always several ectopic NBs remaining located at the medial edge inside the double knockdown clone. The location of those ectopic NBs indicates that they are likely the oldest NBs unable to exit the cell cycle. Therefore, Nerfin-1 may function through a different mechanism in the final-stage NBs, which is not dependent on the downregulation of Notch signaling. Finally, it was shown that Nerfin-1 is not required for Gcm expression, and it remains to be determined whether Gcm regulates Nerfin-1's expression in this process (Zhu, 2022).

Fourth, complex cross-regulations were observed among TTFs that form temporal gene networks. The model for the cross-regulations between medulla TTFs was that each TTF activates the next TTF and inhibits the previous TTF from the Ey stage to the end of the cascade, exhibiting a simple combination of feedforward activation and feedback repression. However, based on the experimental evidenc,e as well as inferred from the scRNA-seq data, the cross-regulations among TTFs are more complex. One TTF is not necessarily repressed by the very next TTF, or activated by the exactly previous TTF. Hth is repressed by Opa and Erm. SoxN is repressed by Ey, while Dmrt99B is likely to be repressed by Slp or later TTFs. Tll is activated just before Gcm, however, Tll is not required for Gcm's activation. The complexity of their cross-regulation is a way to increase the number of combinations of TTFs in aging NBs, thereby increasing the number of possible neuron fates determined along with the temporal progression. However, the overall trend that early TTFs activate late TTFs, and late TTFs repress early TTFs remains valid (Zhu, 2022).

Finally, the speed of the TTF cascade progression is regulated by Lola factors expressed in all NBs. Lola proteins belong to a BTB/POZ family of proteins which have been shown to be involved in chromatin remodeling and organization. Certain isoforms of Lola are expressed in all NBs, e.g., Lola-F is activated one cell cycle earlier than Opa. WLola proteins function as a speed modulator of the temporal cascade progression. It represses the expression of Hth, facilitates the activation of Opa and the following TTFs to different extents, thereby guaranteeing a quick transition from the NE TTF network to the NB TTF network. Interestingly, the vertebrate ortholog of lola, Zbtb20, was also found to modulate the sequential generation of different neural types in cortical progenitors. Loss of Zbtb20 causes the temporal transitions to be delayed further and further, very similar to the loss of lola phenotype in this system. Thus, it is possible that lola/Zbtb20 play conserved roles in the temporal patterning of neural progenitors (Zhu, 2022).

In summary, the entire life of a medulla neuroblast from the beginning to the end was revealed in this study. This comprehensive study of the medulla neuroblast temporal cascade illustrated mechanisms that may be conserved in the temporal patterning of neural progenitors. The single-cell RNA-sequencing data provide a plethora of information that allows further exploration of the mechanisms of temporal patterning (Zhu, 2022).

REGULATION

Promoter

Conserved sequence block clustering and flanking inter-cluster flexibility delineate enhancers that regulate nerfin-1 expression during Drosophila CNS development

Clusters of conserved sequences constituting discrete modular enhancers within the Drosophila nerfin-1 locus. nerfin-1 encodes a Zn-finger transcription factor that directs pioneer interneuron axon guidance. nerfin-1 mRNA is detected in many early delaminating neuroblasts, ganglion mother cells and transiently in nascent neurons. The comparative genomics analysis program EvoPrinter revealed conserved sequence blocks both upstream and downstream of the transcribed region. By using the aligning regions of different drosophilids as the reference DNA, EvoPrinter detects sequence length flexibility between clusters of conserved sequences and thus facilitates differentiation between closely associated modular enhancers. Expression analysis of enhancer-reporter transgenes identified enhancers that drive expression in different regions of the developing embryonic and adult nervous system, including subsets of embryonic CNS neuroblasts, GMCs, neurons and PNS neurons. In summary, EvoPrinter facilitates the discovery and analysis of enhancers that control crucial aspects of nerfin-1 expression (Kuzin, 2009).

Prior studies have shown that an 11 kb genomic DNA fragment that includes the nerfin-1 transcribed sequence and 5780 bp of 50 and 2130 bp of 30 flanking sequence can rescue the nerfin-1null lethal phenotype and restore its wild-type expression pattern. EvoPrinter analysis of the nerfin-1 rescue fragment reveals four regions of DNA sequence conservation: flanking the transcribed sequence, within the open reading frame and within both the 5' and 3' UTRs. Within the nerfin-1 open reading frame, the conserved bases encode the highly conserved DNA-binding domain and the conserved bases within the 3' UTR correspond to multiple micro-RNA binding sites. These conserved micro-RNA binding sites regulate nerfin-1 spatial and temporal translation dynamics in the developing nervous system. The 5' upstream region of the nerfin-1 rescue fragment contains 77 CSBs with an average sequence length of 17.5 bp - slightly higher than the average CSB length reported previously, 13 bp, for a larger selection of enhancers. The longest CSB among these conserved clusters was 42 bases in length (Kuzin, 2009).

This study used the distribution of the CSBs flanking the nerfin-1 structural gene to formulate a strategy for the functional dissection of cis-regulatory sequences. The analysis is based on the idea that enhancers consist of clusters of conserved bases. The clustering of CSBs within the non-transcribed regions of the nerfin-1 locus indicates that multiple enhancers regulate nerfin-1 expression. It was noticed that the length of the less-conserved sequences between the CSB clusters varies between species. The variability in sequence length between and within clusters is demonstrated in the accompaning table, which shows the mean cluster size and coefficient of variation for inter- and intra-cluster sequences. In each case the variability of the inter-cluster non-conserved regions was greater than that of less-conserved regions between CSBs within clusters. The degree of sequence length variability in the between cluster regions was most pronounced when evolutionarily distant species were compared. For example, the sequence length variability between clusters 5 and 6 in Drosophila melanogaster and Drosophila mojavensis is considerably greater than the sequence length variability within each of the two clusters. As a notable exception to the higher inter-cluster variation, the intra-cluster region within fragment #6 shows a coefficient of variation between the low intra-cluster variation of other 5' clusters and the higher inter-cluster variations. The greater intra-cluster variation in fragment #6 can be explained by the fact that it contains multiple enhancers that can act independently of one another (Kuzin, 2009).

To determine whether the CSB clusters detected by EvoPrinter function as independent enhancers, enhancer-reporter transgenes were generated of the different regions detected in the comparative genomics analysis. Genomic regions in distal clusters #2 and #3, which spanned adjacent CSB clusters, activated reporter expression in different subsets of embryonic ventral cord neurons. The more proximal genomic region #4 activated expression in a wider subset of neurons during embryonic stage 15. No larval expression was detected for transgenes #2, #3 and #4. Genomic region #5 did not activate expression during embryonic development but drove reporter expression in a ring of cells in the optic lobe of 3rd instar larva. Expression in the larval optic lobe appears to coincide with the outer proliferative center of the optic lobe. These cells are likely to be newly formed neural precursors whose progeny generate the outer medulla and lamina neurons and the glia of the optic lobe. Fragment #6, which contains multiple clusters of CSBs, activated expression in a subset of early NBs as well as in GMC and PNS neurons (Kuzin, 2009).

The 3' region of the nerfin-1 locus activated reporter expression in a subset of lateral ventral cord NBs during embryonic stage 12 and in a subset of cells in the developing optic lobe of the 3rd instar larva (Kuzin, 2009).

The initial round of enhancer-reporter constructs revealed that the early NB enhancer resided within the multi-cluster fragment #6. To further define the NB enhancer, truncation analysis of fragment #6 was undertaken. Previous studies suggested independent regulation of nerfin-1 in ventral cord NBs and GMCs since the temporal course of NB expression differed markedly from that of ventral cord GMC expression. In an attempt to localize the nerfin-1 NB enhancer and distinguish it from the GMC enhancer, two additional constructs (#11 and #12) were prepared that contained respectively the conserved part of the upper region and the lower region of fragment #6. Fragment #11 revealed no detectable embryonic expression. Fragment #12 was sufficient for combined GMC, PNS and neuronal expression, and also drove expression in neurons behind the morphogenetic furrow of the eye imaginal disc. Extending fragment #12 distally to include the conserved putative bHLH DNA-binding E-box sequences (CAGCTG) did not expand its expression to NBs. This analysis indicates that fragment #6 contains at least two distinct enhancer activities: this region drives reporter expression in many early NBs and GMCs, and the proximal sequences of fragment #6 activates expression in GMCs and neurons and in photoreceptor neurons of the eye imaginal disc. Further truncation analysis of fragment 6 revealed that the nerfin-1 early NB enhancer was located 249 bp upstream of the predicted transcription start site and spans 567 bp (Kuzin, 2009).

The early NB enhancer drives expression during a narrow temporal window of ~2 h, with expression in many but not all S1 and S2 NBs starting at late stage 8. Expression was noticeably absent from row 1 NBs. A comparison of transgene and endogenous mRNA expression patterns revealed no significant differences onset, extent or down-regulation of expression. By stage 10, expression is detected in many cephalic lobe NBs and was significantly downregulated in the ventral cord NBs. By stage 11, expression was absent from the ventral cord and remained in only a few brain NBs. In general, detection of the reporter mRNA levels confirmed the expression pattern detected by immunostaining, however, the reporter protein perdures much longer than its transcript (Kuzin, 2009).

It is noteworthy that, with the exception of fragment #11, each of the different nerfin-1 enhancers identified contains conserved bHLH transcripton factor (TF) DNA-binding sites, which may be targeted by proneural TFs. Of special interest are the three evolutionarily conserved CAGCTG sites within the early NB enhancer - identical sites are also present in multiple copies in the deadpan NB enhancer and in the nervy NB enhancer (Brody, 2008), suggesting that there is specific proneural input into these enhancers. Previous in vitro studies have indicated that the CAGCTG sites function as high affinity binding sites for Daughterless + Achaete and Daughterless + Scute heterodimers. The involvement of the achaete-scute complex in nerfin-1 NB expression was tested by examining nerfin-1 expression in an ac-sc null background. An altered, but not complete absence, of expression, was observed indicating that either ac and/or sc TFs are direct activators of the early nerfin-1 NB enhancer. The enhancer fragment #11, lacking bHLH sites, contains short conserved sequence elements that are found in other PNS/disc enhancers but are absent from a collection of mesodermal enhancers. Specifically, GTGGAAA, AAGGACAA and CAATGAT are conserved sequences in fragment #12, which contains the PNS enhancer: these are also present in the scratch PNS enhancer. The conserved elements AAAAGGG and TCGAGC are also present as conserved sequences in the deadpan PNS enhancer. These elements may play specific roles in PNS/disc enhancers that allow them to be activated in neuronal cells independently of proneural gene action. Further studies are needed to identify the factors binding these elements and their specific functions (Kuzin, 2009).

The principle findings of this study are twofold; (1) phylogenetic footprinting is an efficacious tool for identifying cis-regulatory DNA and (2) the lack of conservation within sequences flanking closely associated enhancers reveals their functional autonomy. By using the aligning regions of different species, Evo-Printer facilitates examination of the evolutionary cohesiveness of enhancers and thus reveals the lack of constrained structure within their flanking sequences. With this approach multiple enhancers were identified that regulate the dynamic expression of nerfin-1 during nervous system development, including enhancers that activate expression in NBs, GMC and neurons of the CNS, in nascent neurons of the PNS, and in neurons of the eye disc and optic lobe precursors (Kuzin, 2009).

Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, were used to characterize highly conserved sequences that are shared among co-regulating enhancers. Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs) made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. Information gained from the comparative analysis was used to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function (Brody, 2008).

To determine the extent to which neural precursor cell enhancers share highly conserved sequence elements, cis-Decoder analysis was performed of in vivo characterized enhancers. This analysis revealed the presence of both novel elements and sequences that contained consensus DNA-binding sites for known regulators of early neurogenesis. None of the illustrated conserved neural specific sequence elements within two or more neural precursor cell enhancers were present in a collection of 819 CSBs from in vivo characterized mesodermal enhancers, thus ensuring their enrichment in neural enhancers. Consensus binding sites for known TFs were represented: basic Helix-Loop Helix (bHLH) factors and Suppressor of Hairless [Su(H)], respectively acting in proneural and neurogenic pathways; Antennapedia class homeodomain proteins, identified by their core ATTA binding sequence, and the ubiquitously expressed Pbx- (Pre-B Cell Leukemia TF) class homeodomain protein Extradenticle, a cofactor of many TFs, identified by the core binding sequence of ATCA. More than half the conserved elements, termed cis-Decoder tags or cDTs were novel, without identified interacting proteins. Many of the CSBs consisted of 8 or more bp, and often contained core sequences identical to binding sites for known factors as well as other core sequences that aligned with shorter novel cDTs, suggesting that the longer cDTs may contain core recognition sequences for two or more TFs (Brody, 2008).

Most cDTs discovered in this analysis represent elements that are shared pairwise, i.e., by only two of the NB enhancers examined (see the website for a list of cDTs that are shared by only two of the enhancers examined). The fact that the majority of cDTs are shared two ways, with only a small subset of sequences being shared three or more ways, suggests that the cis-regulation of early neural precursor genes is carried out by a large number of factors acting combinatorially and/or that many of the identified cDTs may in fact represent interlocking sites for multiple factors, and the exact orientation and spacing of these sites may differ among enhancers (Brody, 2008).

During Drosophila neurogenesis, bHLH proteins function as proneural TFs to initiate neurogenesis in both the central and peripheral nervous system. TFs encoded by the achaete-scute complex function in both systems, while the related Atonal bHLH protein functions exclusively in the PNS. Different proneural bHLH TFs, acting together with the ubiquitous dimerization partner Daughterless, bind to distinct E-boxes that contain different core sequences. In addition to the core recognition sequence, flanking bases are important to the DNA binding specificity of bHLH factors (Brody, 2008).

One of the principle observations of this study was that the core central two bases of the hexameric E-box DNA-binding site (CANNTG; core bases are bold throughout) were conserved in all the species used to generate the EvoPrint. All of the enhancers included in this study contained one or more conserved bHLH-binding sites, with NB and PNS enhancers averaging 3.9 and 4.1 binding sites respectively. More than a third of the core bases in NB bHLH sites contained a core GC sequence, and more than a third of the core bases in PNS bHLH sites contained either a core GC or a GG sequence. The most common E-box among the NB CSBs was CAGCTG with 14 sites in four of the six enhancers. The CAGCTG and CAGGTG E-boxes are high-affinity sites for Achaete/Scute bHLH proteins. However the CAGCTG site itself is not specific to NB enhancers, as evidenced by its presence in four of the mesodermal enhancer CSBs . The most common bHLH-binding site among PNS enhancers was also the CAGCTG E-box with 11 occurrences in six of the 13 enhancers. In contrast, the most common bHLH motif in enhancers of the E(spl)-complex was CAAGTG, with 16 occurrences in 8 of the 11 enhancers. CAGGTG, previously shown to be an Atonal DNA-binding site, was also common in E(spl) enhancers, with 9 occurrences in 8 of the 13 enhancers, but was less prevalent among NB enhancers. The CAGGTG box was also overrepresented in PNS and E(spl) enhancers relative to its appearance in NB enhancers, and it was also present in four of the characterized mesodermal enhancer CSBs. The CAGATG box was present six times among PNS enhancers but not at all among NB enhancers. Thus there appears to be some specificity of E-boxes in the different enhancer types. The fact that each of these E-boxes is conserved in all the species in the analysis, suggests that there is a high degree of specificity conferred by the E-box core sequence (Brody, 2008).

The analysis also revealed that not only are the core bases of E-boxes shared between similarly regulated enhancers, but bases flanking the E-box were also found to be highly conserved and are also frequently shared by these enhancers. Among the E-boxes found in CSBs of NB enhancers (many are illustrated in the accompanying Table aaCAGCTG (core bases of E-box are bold, flanking bases lower case) is repeated three times in nerfin-1 and once in scrt; gCACTTG is repeated three times in scrt; CAGCTGCA is repeated twice in wor, and CAGCTGctg is repeated twice in scrt . In the dpn CNS NB enhancer, the E-box CAGCTG is found twice, separated by a single base (CAGCTGaCAGCTG). None of these sequences were present in mesodermal enhancers examined, but each is found in PNS enhancers; CAGCTGCA is repeated multiple times among PNS enhancers. Among the conserved PNS enhancer E-boxes (CAAATGca, gcCAAATG, cacCAAATGg, CACATGttg, gCACGTGtgc, ttgCACGTG, agCACGTGcc, aCAGATG, ggCAGATGt, CAGCTGccg, CAGCTGcaattt, gCAGGTGta and cCAGGTGa) each, including flanking bases, is found in two or three PNS enhancers, and these are distributed among all 13 enhancers. Of these, only agCACGTGcc, CAGCTGccg, cCAGGTGa were found once in the sample of neuroblast enhancers and none were found in the sample of mesodermal enhancers. The sequence aaCAAGTG is found in 4 E(spl) complex enhancers, those for E(spl)m8, mγ, HLHmδ and m6, and the sequence aCAGCTGc is found twice in E(spl)m8 and once in m4 and m6; neither sequence was found in the mesodermal enhancers. Therefore, although a given hexameric sequence may often be shared by all three types of enhancers, NB, PNS and E(spl), when flanking bases are taken into account there appears to be enhancer type-specific enrichment for different E-boxes (Brody, 2008).

Antennapedia class homeodomain proteins play essential roles in multiple aspects of neural development including cell proliferation and cell identity. The segmental identity of Drosophila NBs is conferred by input from TFs encoded by homeotic loci of the Antennapedia and bithorax complexes. For example, ectopic expression of abd-A, which specifies the NB6-4a lineage, down-regulates levels of the G1 cyclin, CycE. Loss of Polycomb group factors has been shown to lead to aberrant derepression of posterior Hox gene expression in postembryonic NBs, which causes NB death and termination of proliferation in the mutant clones (Brody, 2008).

This study examined the enhancer-type specificity of sequences flanking the Antennapedia class core DNA-binding sequence, ATTA. Nearly 25% of the NB and PNS CSBs examined in this study contain this core recognition sequence. ATTA-containing sites were found multiple times in selected NB and PNS enhancers. The cis-Decoder analysis identified 18 different neural specific ATTA containing cDTs that were exclusively shared by two or more PNS enhancers or CNS enhancers and 10 were found to be shared between PNS and CNS. The most common cDT, ATTAgca, was shared by two CNS and two PNS enhancers; consensus homeodomain-binding sites are bold, flanking sequence lower case). In addition, 6 homeodomain-binding site cDTs were found twice in wor CSBs, aATTAccg, tttgaATTA, aatcaATTA, ATTAATctt and aaacaaATTAg, but not in other CNS or PNS enhancer CSBs. In some cases these cDTs were found repeated in given enhancer CSBs. Only one of these cDTs aligned with CSBs of enhancers of the E(spl) complex. Given that 2/3 of the occurrences of HOX sites in these promoters can be accounted for by cDTs whose flanking sequences are shared between enhancers, it is unlikely that the appearance of these shared sequences occurs by chance (Brody, 2008).

In summary, the appearance of Hox sites in the context of conserved sequences shared by functionally related enhancers suggests that the specificity of consensus homeodomain-binding sites is conferred by adjacent bases, either through recognition of adjacent bases by the TF itself or in conjunction with one or more co-factors (Brody, 2008).

Examination of the cDTs from Drosophila NB and PNS enhancers revealed that many contained the core Pbx/Extradenticle docking site ATGA. In Drosophila , Extradenticle has been shown to have Hox-dependent and independent functions. Studies have also shown that Pbx factors provide DNA-binding specificity for homeodomain TFs, facilitating specification of distinct structures along the body axis. In the CNS enhancers of Drosophila , most predicted Pbx/Extradenticle sites are not, however, found adjacent to Hox sites (Brody, 2008).

Cytoscape analysis of Pbx motifs revealed that 8 were shared between CNS and PNS enhancer types, and 16 were shared between similarly expressed enhancers, thus indicating that there appears to be some degree of specificity to Pbx site function when flanking bases are taken into account. Three of the Pbx binding-site containing elements also exhibit ATTA Hox sites: 1) the dodecamer GATGATTAATCT (Pbx site is ATGA, Hox sites in bold) shared by the PNS enhancers edl and amos , contains a homeodomain ATTA site that overlaps the Pbx site by a single base, and 2) the smaller heptamer ATGATTA, shared by pfe and ato, likewise contains a homeodomain ATTA site (bold) that overlaps ATGA Pbx site by a single base. Adjacent Hox and Pbx sites have been documented to facilitate synergy between the two factors. Taken together these findings suggest that, as with homeodomain-binding sites, the conserved bases flanking putative Pbx sites are functionally important. These flanking bases are likely to confer different DNA-binding affinities for Pbx factors or are required for binding of other TFs (Brody, 2008).

Also indicating a degree of biological specificity of enhancer types is the distribution of Suppressor of Hairless Su(H) binding sites among neural enhancers. Su(H) is the Notch pathway effector TF of Drosophila . The members of the E(spl) complex, both the multiple basic helix-loop-helix (bHLH) repressor genes and the Bearded family members, have been shown to be Su(H) . The consensus in vitro DNA binding site for Su(H) is RTGRGAR (where R = A or G). Notch signaling via Su(H) occurs through conserved single or paired sites and the presence of conserved sites for other transcription regulators associated with CSBs containing Su(H) binding sites has been documented (Brody, 2008).

Within the CSBs of the six NB enhancers examined, only two, dpn and wor, contained conserved putative Su(H)-binding sites; two dpn sites matched one of the Su(H) consensus sites (GTGGGAA) and two wor sites match the sequence ATGGGAA. Only one of the two dpn sites contained flanking bases conforming to the widely distributed CGTGGGAA site of E(spl) Su(H) binding sites and none of the NB enhancers contained paired Su(H) sites typical of the E(spl) enhancers. Of the 13 PNS cis-regulatory regions examined, only four enhancers contained putative Su(H)-binding sites [sna and ato (ATGGGAA), brd (GTGGGAG)] and dpn (GTGGGAA). dpn also contained a pair of sites that conforms to the SPS configuration frequently found in Su(H) enhancers (CSB sequence: AATGTGAGAAAAAAACTTTCTCACGATCACCTT, Su(H) sites in bold, Pbx site is ATCA). The lack of Su(H) sites in PNS enhancers has been noted in a previous study, and it was suggested that these enhancers are directly regulated by the proneural proteins but not activated in response to Notch-mediated lateral inhibitory signaling. Among the conserved sequences of E(spl) gene enhancers there is an average of 3.4 consensus Su(H) binding sites per enhancer, with most enhancers containing both types of sites, i.e., those with either A or G in the central position (Brody, 2008).

This study offers three insights with respect to Su(H) binding sites. First, although in vitro DNA-binding studies suggest there is a flexibility in the Su(H) binding site, like the bHLH E-box, comparative analysis shows that within any one the Su(H) sites there is no sequence flexibility. Except for the pair of Su(H) sites in the dpn PNS enhancer, none of the CNS or PNS sites contained a central A; less that a quarter of the E(spl) sites consisted of a central A, and all these were conserved across all species examined. In light of the high conservation in these regions the invariant core and flanking sequences are important for the unique Su(H) function at any particular site (Brody, 2008).

A second finding was the extensive conservation of bases flanking the consensus Su(H) sequence in the E(spl) complex genes. For example, the cDT GTGGGAAACACACGAC [Su(H) site bold] was present in HLHm3 and HLHm5 enhancer CSBs, and ACCGTGGGAAAC was conserved in HLHm3 and HLHmβ enhancers. The conservation of bases flanking the consensus Su(H) binding site suggests that the Su(H) site may be flanked by additional binding sites for co-operative or competitive factors, or else, that Su(H) contacts additional bases besides the consensus heptamer (Brody, 2008).

A third observation is that in most cases Su(H) binding sites are imbedded in larger CSBs, suggesting that CSB function is regulated by the integrated function of multiple TFs. For example the dpn NB enhancer Su(H) site is imbedded in a CSB of 24 bases, and the atonal PNS enhancer Su(H) site is imbedded in a CSB of 45 bases. In the E(spl) complex, CSB #6 of HLHmγ, consisting of 30 bases and CSB#13 of m8, consisting of 31 bases (each contains a GTGGGAA Su(H) site, a CACGAG element, conforming to a Hairy N-box consensus CACNAG, and an AGGA Tramtrack (Ttk) DNA-binding core recognition sequence, but the order and context of these three sites is different for each enhancer). Although Su(H) binding sites were present in only a minority of NB and PNS enhancers, the conservation of core bases, as well as the complexity of their flanking conserved sequences points to a diversity of Su(H) function and interaction with other factors (Brody, 2008).

Neural specific cDTs contain core DNA-binding sites for other known TFs. Two of these elements, one exclusively present in NB enhancers (CAGGATA) and a second exclusively present in PNS enhancers (GTAGGA), contained consensus core AGGA DNA-binding sites for Ttk, a BTB domain TF that has been shown to regulate pair rule genes during segmentation and to repress neural cell fates. Another site (CACCCCA), shared by both NB and PNS enhancers, conforms to the consensus binding site of IA-1 (ACCCCA), the vertebrate homolog of nerfin-1 . Most of the neural specific sequence elements illustrated in the paper do not contain sequences corresponding to consensus binding-sites of known regulators of NB expression. The fact that they are represented multiple times in NB CSB sequences suggests that they contain binding sites for unknown regulators of neurogenesis in Drosophila (Brody, 2008).

Neural enriched cDTs that are shared between multiple NB enhancers and also exhibit a low frequency in the sample of mesodermal enhancers examined in this study serve as a resource for understanding enhancer elements that may not have an exclusive neural function [see cis-Decoder tags with multiple hits on two or more NB enhancers]. Notable here is the presence of CAGCTG bHLH DNA binding sites (all with flanking A, CC and TC) and Antennapedia class homeobox (Hox) core DNA binding site ATTA, as well as additional Ttk and Pbx/Extradenticle sites. Present in this list are portions of sequences conforming to Su(H) binding sites. Of particular interest are sequences that are also enriched in the PNS; these sites may bind factors that play similar developmental roles in different tissues. For example, the presumptive Ttk site, AAAGGA (core sequence in bold) is highly enriched in segmental enhancers. Thus, some of these sites can be identified as targets of known TFs, but the identity of most are as yet unknown. These elements shared by multiple enhancers may be useful in identifying other enhancers driving expression in NBs (Brody, 2008).

EvoPrint analysis revealed that all of the enhancer regions examined in this study contained multiple CSBs that were greater that 15 to 20 bases in length. The occurrence of overlapping DNA-binding sites for different TFs is currently the best explanation for the maintenance of intact CSB sequences across ~160 millions of years of collective species divergence. This analysis has revealed that the sequence context, order and orientation of shared cDTs can differ between co-regulating enhancers (Brody, 2008).

Two examples are given here of the complex contextual appearance of cDTs. Each of the eight illustrated CSBs shown was nearly fully 'covered' by cDTs of the NB library, suggesting that each contains multiple overlapping binding sites for a number of TFs. In these two examples, there is no consistent spatial constraints to the association of known TF-binding sites (i.e., bHLH-binding E-box sites) with novel cDTs; a picture that emerges is one of combinatorial complexity, in which known or novel cDTs are associated with each other in different contexts on different CSBs (Brody, 2008).

The information derived from cis-Decoder analysis of neural precursor cell enhancers was used to search for other genomic sequences with similar cis-regulatory properties. Having identified cDTs found multiple times among NB enhancers, the genomic search tool FlyEnhancer was used to identify Drosophila melanogaster genomic sequences that contained clusters of the following cDTs (number in parenthesis is the total number of each cDT in the sample of six NB enhancers): GGCACG (6), GGAATC (4), TGACAG (6), TGGGGT (4), CAGCTG (14), TGATTT (9) CAAGTG (7), CATATTT (5), TGATCC (7) and CTAAGC (6). As a lower limit, a minimum of three CAGCTG bHLH sites was set for this search, because of the prevalence of this site in nerfin-1 and deadpan NB enhancers. Each sequence detected by this search was subjected to EvoPrinter analysis to determine the extent of its sequence conservation. Among the cDT clusters identified, the search identified a 5' region adjacent to the nervy gene that contained three conserved CAGCTG sites as well five other sites identical to TGACAG, GGAATC, TGGGGT, GGCACG and CATATTT. nervy, originally identified as a target of homeotic gene regulation, is expressed in a subset of early CNS NBs, as well as in PNS SOP cells. Later studies have implicated nervy, along with cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) in antagonizing Sema-1a-PlexA-mediated axonal repulsion, and nervy has been shown to promote mechanosensory organ development by enhancing Notch signaling (Brody, 2008).

EvoPrinter analysis revealed that the cluster of neural precursor cell enhancer cDTs positioned 90 bp upstream from the nervy transcribed sequence contains highly conserved sequences. This region contains 10 CSBs that include six conserved E-boxes, three of which conform to the CAGCTG sequence that was prominent in nerfin-1 and deadpan promoters. To determine if this region functions as a neural precursor cell enhancer, transformant lines were generated containing the nervy CSB cluster linked to a minimal promoter/GFP reporter transgene. This analysis of the reporter expression driven by the nervy upstream fragment revealed a pattern indistinguishable from early nervy mRNA expression. Specifically, expression was detected in a large subset of early delaminating NBs and in SOPs and secondary precursor cells of the PNS. Significantly, the nervy enhancer, unlike nerfin-1 and deadpan NB enhancers, activates reporter expression in then PNS and not just in early NBs (Brody, 2008).

The major finding of this study is that enhancers of co-regulated genes in neural precursor cells possess complex combinatorial arrangements of highly conserved cDT elements. Comparisons between NB and PNS enhancers identified CNS and PNS type-specific cDTs and cDTs that were enriched in one or another enhancer type. cis-Decoder analysis also revealed that many of the conserved sequences contain DNA-binding sites for classical regulators of neurogenesis, including bHLH, Hox, Pbx, and Su(H) factors. Although in vitro DNA-binding studies have shown that many of these factors have a certain degree of flexibility in the sequences to which they bind, defined in terms of a position weight matrix, the studies described in this paper show that for any given appearance these sites are actually highly conserved across all species of the Drosophila genus. The genus invariant conservation in many of these characterized binding sites indicates that there are distinct constraints to that sequence in terms of its function (Brody, 2008).

The high degree of conservation displayed in the enhancer CSBs could derive from unique sequence requirements of individual TFs, or the intertwined nature of multiple DNA-binding sites for different TFs. Thus there is a higher degree of biological specificity to these sites than the flexibility that is detected using in vitro DNA-binding studies. As an example, the requirement for a specific core for the bHLH binding site, i.e., for a CAGCTG E-box for nerfin-1, deadpan and nervy, suggests that it is the TF itself that demands sequence conservation; however, the requirement for conserved flanking sequences suggests that additional specific factors may be involved. Although the inter-species conservation of core and flanking sites has been noted by others, the extent of this conservation is rather surprising. To what extent and how evolutionary changes in enhancer function take place, given the conservation of core enhancer sequences, remains a question for future investigation (Brody, 2008).

In addition to classic regulators of neurogenesis, cis-Decoder reveals additional conserved novel elements that are widely distributed or only detected in pairs of enhancers. Many of these novel elements flank known transcription binding motifs in one CSB, but appear independent of known motifs in another. The appearance of novel elements in multiple contexts suggests that they may represent DNA-binding sites for additional factors that are essential for enhancer function. Only through discovery of the factors binding these sequences will it become clear what role they play in enhancer function (Brody, 2008).

Preliminary functional analysis of CSBs within the nerfin-1 neuroblast enhancer reveals that CSBs carry out different regulatory roles. Altering cDT sequences within the nerfin-1 CSBs reveals that most are required for cell-specific activation or repression or for normal enhancer expression levels. CSB swapping studies reveals that, for the most part, the order and arrangement of a number of tested CSBs was not important for enhancer function in reporter studies. The discovery of the nervy neural enhancer by searching the genome with commonly occurring NB cDTs underscores the potential use of EvoPrinter and cis-Decoder analysis for the identification of additional neural enhancers. By starting with known enhancers and building cDT libraries from their CSBs, one now has the ability to search for other genes expressed during any biological event (Brody, 2008).

Transcriptional Regulation

Comparative analysis of Nerfin-1 and Pros expression in the developing nervous system revealed a marked, although not complete, overlap in expression. The nuclear co-localization of these proteins in neuronal precursor cells, and the fact that mutations in nerfin-1 and pros trigger axon guidance defects, raised the possibility that they may regulate the expression of one another. To determine the epistatic relationship between nerfin-1 and pros, their expression dynamics were studied in each other's loss-of-function mutant backgrounds. Pros immunostaining in nerfin-1^null embryos did not identify any significant changes in Pros expression. In marked contrast, nerfin-1 mRNA and protein levels in embryos collected from two independent loss-of-function pros mutants revealed that pros is required for wild-type nerfin-1 expression levels. Nerfin-1 expression was significantly reduced throughout the CNS and PNS; however, its expression was not completely ablated in any of the pros^null alleles tested (Kuzin, 2005).

To determine if the axon guidance phenotype observed in pros^null (pros^I13) mutant embryos could be explained by a requirement for wild-type nerfin-1 expression, the extent of CNS axon disorganization triggered by single and double mutant combinations were examined. Comparisons demonstrated that loss of pros function resulted in a more severe phenotype than that observed in the nerfin-1^null embryos. Although both pros^null and nerfin-1^null embryos exhibited disruptions in the longitudinal axon connectives, loss of pros function resulted in an overall greater disruption in commissure organization. In addition, the nerve cord in pros^null embryos was considerably wider when compared to nerfin-1 mutants or wild-type embryos. The axon scaffolding phenotype observed in nerfin-1^null; pros^I13 double mutant was more severe than that of either single mutant (Kuzin, 2005).

Analysis of two other transcription factor genes that are widely expressed in the developing CNS, lola and fru, has revealed that they too are required for proper axon guidance and both are required for proper longitudinal axon fasciculation. However, unlike the severe axon guidance phenotype observed in pros^null embryos, the disorganization of the CNS axon scaffolding is not as extensive in lola or fru loss-of-function mutants. To determine the epistatic relationship between nerfin-1 and lola or fru, the expression of each gene in each other's loss-of-function background was analyzed. In contrast to the marked reduction of nerfin-1 expression in pros mutants, no such reduction in nerfin-1 expression was found in lola or fru mutants, nor was the expression of lola or fru altered in nerfin-1^null embryos (Kuzin, 2005).

Targets of Activity

Given the axon guidance defects in nerfin-1^null embryos and the fact that Nerfin-1 is a Zn-finger nuclear protein, it was hypothesized that Nerfin-1 may be required for the correct expression of genes involved in axon guidance. Accordingly, the embryonic expression profiles of over 35 genes that have been shown to play important roles in axon guidance were examined. Included in the candidate screen were genes encoding transcription factors, RNA-binding proteins, cell surface receptor proteins, their ligands, signal transduction proteins, and components of the cytoskeleton. Homozygous nerfin-1^null embryos were identified by the absence of Nerfin-1 immunoreactivity. Whole-mount in situ hybridization and/or protein immunostaining for altered spatial or temporal expression in nerfin-1^null embryos identified six genes that require nerfin-1 function to achieve full wild-type expression levels (Kuzin, 2005).

Two genes involved in anterior vs. posterior commissure choice, those encoding the receptor tyrosine kinase Derailed, and its ligand Wnt5, both required nerfin-1 for full expression. In the absence of nerfin-1, ventral cord expression levels of Robo and Robo3 were unaffected; however, Robo2 expression levels were significantly reduced. Expression of Slit, the ligand for Robo receptors, and Commissureless, a factor responsible for clearing Robo receptors from commissural axons, was unaffected in nerfin-1^null embryos (Kuzin, 2005).

Loss of nerfin-1 function also significantly delayed and/or reduced the early expression of the neuron-specific microtubule-associated MAP1B-like gene futsch. futsch expression is normally activated in newborn neurons starting at stage 11; however, in nerfin-1^null embryos expression is first detected only at the stage 13. Not until embryonic stage 15 did the level of futsch expression in mutant embryos approach that of wild type. Reduced mRNA steady state levels for the genes encoding Leukocyte-antigen-related-like (Lar), another receptor tyrosine kinase, and G-oα47A gene, which encodes an alpha subunit of heterotrimeric G proteins, were also detected in nerfin-1^null embryos. The reduced level of gene expression in mutant embryos was nervous system specific. For example, G-oα47A gene expression in mesodermal derived tissues was not altered in nerfin-1^null embryos (Kuzin, 2005).

Hybrid neurons in a microRNA mutant are putative evolutionary intermediates in insect CO2 sensory systems: Loss of a microRNA miR-279, which regulates nerfin-1, results in a switch in cell fate

Carbon dioxide (CO₂) elicits different olfactory behaviors across species. In Drosophila, neurons that detect CO₂ are located in the antenna, form connections in a ventral glomerulus in the antennal lobe, and mediate avoidance. By contrast, in the mosquito these neurons are in the maxillary palps (MPs), connect to medial sites, and promote attraction. In Drosophila loss of a microRNA, miR-279, leads to formation of CO₂ neurons in the MPs. miR-279 acts through down-regulation of the transcription factor Nerfin-1. The ectopic neurons are hybrid cells. They express CO₂ receptors and form connections characteristic of CO₂ neurons, while exhibiting wiring and receptor characteristics of MP olfactory receptor neurons (ORNs). It is proposed that this hybrid ORN reveals a cellular intermediate in the evolution of species-specific behaviors elicited by CO₂ (Cayirlioglu, 2008).

In insects, both the position of CO₂ neurons and the behavior elicited by CO₂ differ among species. For example, olfactory detection of CO₂ through neurons positioned in or around the mouthparts of an insect, such as maxillary palps (MPs) and labial palps, correlates with feeding-related behaviors. Indeed, in some blood-feeding insects such as mosquitoes and tsetse flies, these neurons are harbored in the MPs and are important in locating hosts via plumes of CO₂ that they emit. The hawkmoth, Manduca sexta, monitors nectar profitability of newly opened Datura wrightii flowers through CO₂ receptor neurons located in their labial palps. In these examples, CO₂ acts as an attractant. Conversely, in Drosophila CO₂ is a component of a stress-induced odor that triggers avoidance behavior. This repellent response is driven by antennal neurons expressing the CO₂ receptor complex Gr21a-Gr63a. How did these diverse behavioral responses to CO₂ arise during insect evolution? It is proposed that this diversity emerged through multiple steps, including changes in cellular position (arising from elimination of CO₂ neurons in one appendage and generation of these neurons in another) and changes in circuitry (Cayirlioglu, 2008).

In the course of a genetic screen for mutants disrupting the organization of the olfactory system, a mutant (S0962-07) was isolated that resulted in the formation of ectopic Gr21a-expressing neurons in the MPs. Some 22 ± 1.5 (mean ± SEM) green fluorescent protein (GFP)-positive cells were observed in the mutant MP, whereas the number of antennal Gr21a olfactory receptor neurons (ORNs) was unaffected. In the wild type, Gr21a cell bodies were restricted to the antenna. The ectopic MP cells expressed both CO₂ receptors (Gr21a and Gr63a). Consistent with this finding, mutant cells conferred CO₂ sensitivity to the MP. Staining the MP with an antibody to the pan-neuronal marker Elav revealed an increase of 21 ± 3.4 neurons in the mutant, which suggests that all ectopic neurons expressed Gr21a (Cayirlioglu, 2008).

In wild-type MPs, each sensillum contains two ORNs. By contrast, in the mutant MP sensilla, additional neurons expressing Elav and the general receptor Or83b were observed. This was also apparent when a MP ORN marker (MPS-GAL4) expressed in a subset of MP ORNs was used. This marker labels single cells within a subset of wild-type MP sensilla; however, in mutant MPs, two additional neurons were observed, bringing the total number of neurons within these sensilla to four. Thus, the generation of ectopic Gr21a-Gr63a neurons is due to an increase in the number of neurons within sensilla rather than transformation of MP ORNs (Cayirlioglu, 2008).

In the wild type, each class of adult ORNs sends projections from both antennae or MPs to the antennal lobe (AL). ORNs expressing same odorant receptors (ORs) typically form synapses in the same glomerulus within the AL. CO₂ neurons in the antenna target the V-glomerulus. To specifically assess the targeting of ectopic MP CO₂ neurons, flies were examined where the antennae were surgically removed. It was found that ectopic CO₂ neurons targeted the V-glomerulus and other medial sites in the AL. The wiring specificity of antennal CO₂ neurons in the mutants was identical to that in the wild type. Thus, the ectopic CO₂ neurons in the MP target, at least in part, the same glomerulus innervated by the wild-type CO₂ neurons in the antennae (Cayirlioglu, 2008).

S0962-07 was mapped to a P-element insertion some 1 kb upstream of a microRNA, miR-279. MicroRNAs (miRNAs) are small noncoding RNAs of about 22 nucleotides that bind to specific sequences of the 3'-untranslated region (3'UTR) of target genes and thereby repress gene expression posttranscriptionally. In recent years, miRNAs were implied in a variety of functions in the nervous system of different organisms. To assess whether miR-279 is responsible for the observed phenotype, three small deletions were generated that uncovered the miR-279 genomic region. These deletion mutants exhibited phenotypes indistinguishable from S0962-07. The ectopic CO₂ phenotype was rescued by a 3-kb fragment of genomic DNA encoding only miR-279. Thus, miR-279 is the gene disrupted in S0962-07 and must repress targets in the MP to inhibit ectopic CO₂ neuron development (Cayirlioglu, 2008).

To assess whether miR-279 is expressed in the developing MPs, transgenic flies were generated carrying a transcriptional reporter construct (miR-279-GAL4). Expression was monitored in flies carrying this GAL4 construct and the reporter UAS-mCD8GFP. Around 40 to 50 hours after puparium formation (APF), large cells reminiscent of sensory organ precursors in other epithelia expressed miR-279. At later stages, miR-279-expressing cells were found in clusters with smaller cells, some of which expressed neuronal markers. As ORNs matured, miR-279 expression was lost (Cayirlioglu, 2008).

Attempts were identify the target gene(s) responsible for the miR-279 mutant phenotype. About 205 potential target mRNAs of miR-279 were previously predicted. One of the strongest candidates for miR-279 regulation is Nerfin-1. The Nerfin-1 3'UTR contains multiple miR-279 binding sites and encodes a transcription factor expressed in neuronal precursors and transiently in nascent neurons in the embryonic central nervous system. Nerfin-1 protein appeared in miR-279-positive cells between 50 and 60 hours APF. Nerfin-1 and miR-279 gradually redistributed, generating complementary expression patterns. Cells with high levels of Nerfin-1 expressed low levels of miR-279 and vice versa (Cayirlioglu, 2008).

To test whether Nerfin-1 is up-regulated in miR-279 mutants, mutant MPs were stained with antibodies to Nerfin-1. 22 ± 4.8 additional Nerfin-1-expressing cells were found in miR-279 mutant MPs relative to controls. This is similar to the number of ectopic CO₂ neurons in the MP. The vast majority of CO₂ ORNs in the MP expressed Nerfin-1. Thus, the expression pattern of Nerfin-1 protein in the wild type and in mutant MPs is consistent with nerfin-1 mRNA being a target for miR-279 in vivo (Cayirlioglu, 2008).

To determine whether miR-279 directly binds to nerfin-1 3'UTR and inhibits its expression, a luciferase reporter assay was used in cultured cells. The luciferase-coding region was fused to the full-length nerfin-1 3'UTR, which contains four conserved 8-nucleotide oligomer target sites for miR-279, as well as to a subregion containing three of these sites. Luciferase activity of both nerfin-1 sensor constructs was strongly repressed when cells were cotransfected with miR-279. By contrast, the activity of either nerfin-1 sensor was unaffected by noncognate miR-315. Antisense oligomers directed against the miR-279 core sequence specifically relieved nerfin-1 reporter repression. Thus, it is concluded that nerfin-1 is a direct target of miR-279 (Cayirlioglu, 2008).

Next whether Nerfin-1 down-regulation by miR-279 inhibits the development of CO₂ neurons in the MPs was assessed. To do this, the level of nerfin-1 was reduced by half genetically in a miR-279 mutant background. This decreased the number of CO₂ neurons in the MP relative to miR-279 mutants, providing strong in vivo evidence that miR-279 is necessary to down-regulate Nerfin-1 in MPs during normal development. Nerfin-1 up-regulation alone was not sufficient to generate a miR-279-like phenotype. Taken together, these findings suggest that miR-279 down-regulates Nerfin-1 and other targets to prevent CO₂ neuron development in the MPs (Cayirlioglu, 2008).

When analyzing the axonal projections of the CO₂ neurons in the MPs, it was observed that these neurons targeted one or more medial glomeruli in addition to the V-glomerulus, the target of antennal CO₂ neurons. These medial glomeruli are normally innervated by MP Or42a and Or59c ORNs. Double-labeling experiments revealed that mutant neurons also coexpressed Or42a and Or59c, but not other MP ORs. Analysis of subsets of MP ORNs also revealed that Or42a and Or59c classes each showed an approximate increase of 10 cells in the MPs, whereas others were unaffected. These results indicate that the ectopic CO₂ neurons are formed as additional cells within Or42a and Or59c sensilla and are hybrid in identity. They express ORs and exhibit wiring characteristics of two classes of neurons (Cayirlioglu, 2008).

It is interesting that the loss of miR-279 generates a CO₂ neuron within a sensillum harboring four neurons in the MP, given that the antennal CO₂ sensilla in Drosophila are the only sensilla in the olfactory system to harbor four ORNs. Because miR-279 acts within the precursor cells in the MP to prevent Nerfin-dependent formation of olfactory neurons, this observation raises the intriguing possibility that positioning of CO₂ neurons on different olfactory appendages might have evolved through changes at the level of precursor cell development. Thus, the evolutionary elimination of CO₂ neurons from MP sensilla might have required decreasing the number of cells with neuronal identities through down-regulation of Nerfin-1 by miR-279 (Cayirlioglu, 2008).

Although it was hypothesized that relocation of CO₂ ORNs to different appendages was important in the evolution of differences in CO₂ sensing, additional mechanisms must have evolved to modify the neural circuitry to alter species-specific behaviors in response to CO₂. The ectopic CO₂ neurons are hybrid cells, which express additional receptors (Or59c or Or42a) and also target medial glomeruli, typically innervated by wild-type ORNs expressing these ORs. This is particularly interesting given that CO₂ neurons in mosquitoes connect to medial glomeruli, driving an attractive response. It is speculated that this hybrid cell represents an evolutionary intermediate on a path leading to species-specific CO₂ behavior. Perhaps suppressing the expression of Or59c or Or42a ORs could convert this hybrid cell to one dedicated only to CO₂ reception. The nature of the behavioral output to CO₂ (i.e., attraction versus repulsion) by this cell, however, may be dictated by altering the wiring specificity to one site or the other (medial versus ventral, respectively). More generally, it is proposed that natural selection can work on such an evolutionary intermediate to generate different combinations of OR, wiring, and cellular positional specificities, depending on the insects' environmental needs. This may in turn lead to novel olfactory responses to different odorants, or to the same odorant in different species (Cayirlioglu, 2008).

The Drosophila nerfin-1 mRNA requires multiple microRNAs to regulate its spatial and temporal translation dynamics in the developing nervous system

The mRNA encoding the Drosophila Zn-finger transcription factor Nerfin-1, required for CNS axon pathfinding events, is subject to post-transcriptional silencing. Although nerfin-1 mRNA is expressed in many neural precursor cells including all early delaminating CNS neuroblasts, the encoded Nerfin-1 protein is detected only in the nuclei of neural precursors that divide just once to generate neurons and then only transiently in nascent neurons. Using a nerfin-1 promoter controlled reporter transgene, replacement of the nerfin-1 3' UTR with the viral SV-40 3' UTR releases the neuroblast translational block and prolongs reporter protein expression in neurons. Comparative genomics analysis reveals that the nerfin-1 mRNA 3' UTR contains multiple highly conserved sequence blocks that either harbor and/or overlap 21 predicted binding sites for 18 different microRNAs. To determine the functional significance of these microRNA-binding sites and less conserved microRNA target sites, their ability to block or limit the expression of reporter protein was studied in nerfin-1 expressing cells during embryonic development. The results indicate that no single microRNA is sufficient to fully inhibit protein expression but rather multiple microRNAs that target different binding sites are required to block ectopic protein expression in neural precursor cells and temporally restrict expression in neurons. Taken together, these results suggest that multiple microRNAs play a cooperative role in the post-transcriptional regulation of nerfin-1 mRNA, and the high degree of microRNA-binding site evolutionary conservation indicates that all members of the Drosophila genus employ a similar strategy to regulate the onset and extinction dynamics of Nerfin-1 expression (Kuzin, 2007).

During embryonic stage 10, nerfin-1 mRNA is detected in all early delaminating CNS NBs albeit at differing levels; and within many of the NBs the message appears to be asymmetrically distributed. Although nerfin-1 mRNA expression is pan-neural during this early stage in CNS development, immunostains using different Nerfin-1 specific polyclonal antibodies detect significant levels of Nerfin-1 protein only in the ventral cord MP2 NBs. The punctate/irregular distribution of the nerfin-1 mRNA in NBs lacking detectable levels of Nerfin-1 protein is reminiscent of that observed for mRNAs targeted for miRNA mediated cleavage in mammals, suggesting that nerfin-1 message in many of the NBs may likewise be targeted for degradation (Kuzin, 2007).

Although the dynamics of nerfin-1 mRNA and protein expression differ considerably during the early stages of nervous system development, by stage 13 the pattern of Nerfin-1 expression closely matches that of its mRNA and close inspection of nerfin-1 message distribution in the Nerfin-1 protein expressing cells revealed an even cytoplasmic distribution. Expression of both the message and protein in the new born CNS and PNS neurons is short lived; levels of both rapidly decline such that by late stage 14 both message and protein levels are significantly lower throughout the nervous system (Kuzin, 2007).

miRNA target prediction programs have identified multiple putative miRNA binding sites within the nerfin-1 1,622 bp 3' UTR and many of these sites are conserved in other nerfin-1 Drosophila orthologues. For example, a Drosophila EvoPrint (Odenwald, 2005) of the nerfin-1 locus (using D. melanogaster as the reference sequence and D. sechellia, D. yakuba, D. erecta, D. ananassae, D. persimilis, D. pseudoobscura, D. willistoni, D. mojavensis and D. grimshawi as test sequences) revealed conserved sequence blocks within the 3' UTR that contain or overlap 21 predicted miRNA binding sites for 18 different miRNAs. The conserved sequences are present in all, or all but one, species used in the analysis and represent over 100 million years of collective evolutionary divergence. The partial and/or interrupted conservation within the predicted miRNA binding sites may reflect the fact that initial base-pairing of an miRNA and its mRNA target sequence requires only eight bases to initiate translational regulation. EvoPrint analysis of the nerfin-1 3' UTR also identified additional conserved sequence blocks that do not contain or overlap predicted miRNA binding sites and their role(s) in gene function are currently unknown. In vivo cis-regulatory analysis of the nerfin-1 3' UTR failed to detect any transcriptional enhancer activity. In addition to the conserved miRNA target sites, less conserved predicted binding sites have been identified within the 3' UTR. For example, the central miR-279/miR-286 and miR-279 target sites are present in the species that are evolutionarily close to D. melanogaster but not conserved in the more distant D. persimilis, D. pseudoobscura, D. willistoni, D. mojavensis and D. grimshawi species (Kuzin, 2007).

The conservation of nerfin-1 miRNA sites suggests that miRNA mediated post-transcriptional regulation of nerfin-1 occurs in all members of this genus. MicroRNAs most likely regulate other EIN-domain containing zinc finger genes. For example, multiple miRNA binding sites have also been detected in the vertebrate IA-1 3' UTR, and EvoPrint analysis reveals that one of sites within the human IA-1 gene is highly conserved (Kuzin, 2007).

To determine if the conserved nerfin-1 3' UTR sequences are required for the embryonic NB post-transcriptional regulation, a series of reporter transgene constructs were generated that tested the silencing activity of different regions of its 3' UTR. The starting construct was prepared by replacing the nerfin-1 ORF and 3' UTR in an 11 kb nerfin-1 genomic rescue construct with a sequence that contains the ORF for a nuclear targeted Green Fluorescent Protein (GFP-NLS) linked to the viral SV-40 3' trailer that lacks any predicted miRNA binding sites. As expected, transformants that contain the P[nerfin-1.GFP-NLS.SV-40] construct expressed GFP in all early delaminating CNS NBs and no translational block of GFP expression was detected when compared to nerfin-1 mRNA expression. The full-length or different sub-regions of the nerfin-1 3' UTR containing the conserved sequence blocks were then inserted into a unique restriction site within the vector's SV-40 3' UTR. Embryo GFP-immunostains were performed on multiple independent transformant lines for each construct. As controls, multiple independent transformant lines that contain the nerfin-1 3' UTR sequences in the opposite orientation were also generated for each construct and embryo GFP-immunostains revealed that in all cases the translational block in GFP expression was orientation dependent (Kuzin, 2007).

Insertion of the full-length 3' UTR into the P[nerfin-1.GFP-NLS.SV-40] reporter recapitulated the silencing of nerfin-1 mRNA translation. Similar to the endogenous Nerfin-1 protein expression during embryonic stages 10 and 11, significant levels of GFP expression in the ventral cord were observed only in the MP2 NBs. However, reporter transgenes that contained sub-regions of the 3' UTR gave only partial or no block in NB GFP expression. For example, although the iB and iH constructs, consisting respectively of the conserved 5' and 3' multiple miRNA binding site sub-regions, significantly reduced GFP expression in stage 11 NBs, both of these sub-regions only partially blocked expression during stage 10. Further sub-division of the 5' conserved miRNA binding site cluster (constructs iC, iD and iE) revealed that the overlapping miR-9A, miR-9B and miR-9C binding sites and the miR-279/mir-286 both contributed to the partial inhibition observed with the iB construct, but the conserved Bantam miRNA-binding site did not. It is worth noting that the 5' predicted miR-279/mir-286 target site within the nerfin-1 rescue construct contains the sequence TCTAGTCA that agrees with the predicted miR-279/mir-286 binding site. This sequence differs in the second to last base from that of the D. melanogaster genomic sequence (FlyBase BLAST), in which there is a T in place of C. cDNA sequence analysis of all ESTs in the database reveals a C instead of a T at this position (Kuzin, 2007).

Given that only the full-length insert recapitulates the silencing of endogenous expression in the CNS, it is concluded the miRNAs act in a cooperative fashion to regulate the onset of Nerfin-1 protein expression. The block in translation by sub-regions of the 3' UTR was more effective at stage 11 than at stage 10; this could reflect time of onset of miRNA expression or the possibility that the level of mRNA expression is too high for a complete block at the earlier stage. Previous studies have shown that ectopic expression of nerfin-1 outside the wild-type temporal/spatial boundaries during CNS development results in axon guidance defects. The requirement for multiple miRNA binding sites may reflect the need for tight spatial control of Nerfin-1 expression (Kuzin, 2007).

Dissection of the sub-regions reveals that the miR-9A, miR-9B and miR-9C combined site, as well as the miR-279/mir-286 site, contribute to silencing, but the Bantam site did not show an effect. The conservation of the Bantam site suggests that it is functionally important, but no effect on embryonic CNS expression of nerfin-1 was observed. Consistent with this, no effect on Nerfin-1 protein expression was detected in bantam minus embryos. Bantam has been shown to have developmental roles in post-embryonic development. Analysis of the 3' sub-region sites indicates that in the CNS, the combined miR-279/miR-286 site exhibits partial silencing, with no effect observed for the other miRNA binding sites. Interestingly, the less conserved centrally located miR-279/miR-286 and miR-279 sites did not promote silencing. These two sites share less homology to the miR-279 and miR-286 binding sites than the other conserved miR-279/mir-286 target sites. Construct iG, which contains the overlapping miR-92A, miR-92B, and miR-310-313 sites revealed no detectable miRNA silencing. In addition, construct iK that contains a predicted miR-5 binding site did not affect the reporter mRNA translation in the embryonic CNS and PNS. The other sites in the 3' sub-region exhibited an effect in PNS silencing, suggesting spatial specificity for microRNA effects on nerfin-1 expression (Kuzin, 2007).

During embryonic PNS development, nerfin-1 mRNA and protein are transiently expressed in secondary precursor cells that divide once to generate neurons, and then both its transcript and encoded protein are only transiently detected in nascent neurons. Unlike the post-transcriptional regulation observed in the developing CNS, when the full-length nerfin-1 3' UTR was included in the reporter transgene the onset of GFP expression was not blocked in precursor cells but the duration of GFP expression in the nascent neuron was significantly reduced. The rapid extinction of detectable GFP expression mirrored that of the endogenous Nerfin-1 transient expression; the short-lived expression was observed throughout the PNS in the ventral, lateral and dorsal neurons such that by stage 15 little or no GFP immunostaining was detected. Similar to the reporter results obtained in the CNS for the different 3' UTR sub-regions, no one sub-region or single miRNA binding site was able to fully limit GFP expression in older stage 14 and 15 neurons. However, except for the predicted Bantam miRNA-binding site that showed no detectable effect on silencing GFP expression, all of the other 3' UTR sub-regions exhibited different degrees of silencing. Each of the constructs had differential effects on reporter expression in different cells of the PNS, suggesting an involvement of miRNAs in cell-type regulation of Nerfin-1 expression. For example, construct iB, containing the 5' end of the 3' UTR, exhibited a higher levels of silencing in individual cells of the dorsal and lateral clusters; a construct containing the 3' end of the 3' UTR, exhibited a higher level of silencing in the chordotonal neurons in the lateral cluster than in other cells of the lateral and ventral clusters; another construct containing a subset of sites in the 3' UTR, exhibited a higher level of silencing in a subset of cells in the dorsal and lateral clusters than in other cells of the same clusters (Kuzin, 2007).

Taken together, the data suggest that the miRNA binding sites in the 3' UTR are required to restrict the onset (CNS) and extinction (PNS) dynamics of Nerfin-1 protein expression. The limited expression of Nerfin-1 protein may be the result of translational inhibition and/or enhanced miRNA mediated degradation of the nerfin-1 mRNA. To determine whether mRNA expression dynamics were different for different constructs and thus were affected by the presence of different combinations of nerfin-1 miRNA binding sites, the mRNA expression dynamics of the nerfin-1.GFP-NLS.SV-40 transgene was compared to mRNA expression dynamics of this transgene containing the various nerfin-1 3'UTR fragments. The in situ hybridization mRNA study of embryos containing these different nerfin-1 3' UTR transgene constructs revealed that none of the nerfin-1 miRNA binding site constructs exhibited a marked alteration of the PNS or CNS expression dynamics of the reporter transgene during embryonic development. However, because the in situ hybridizations only reveal relative steady state mRNA levels, the possibility that the miRNAs may be promoting nerfin-1 mRNA degradation cannot definitely be ruled out (Kuzin, 2007).

Whereas the overlapping miR-9A, miR-9B, and miR-9C target sites showed partial silencing of nerfin-1 expression in the CNS, no effect was observed in the PNS. Interestingly, mutational analysis of a miR-9a mutant reveals that it is required for embryonic PNS development, and it has been shown to silence expression of senseless mRNA. However, the current studies show that miR-9A is unlikely to be a dominant regulator of embryonic Nerfin-1 protein expression; analysis with a number of cell fate markers reveal that nerfin-1 mutation is not likely to effect embryonic PNS cell fate and staining miR-9a mutants with antibody to Nerfin-1 reveals no alteration in the number or positions of Nerfin-1 positive cells. In contrast, the miR-305 and miR-13B sites partially reduced reporter expression in the PNS but not in the CNS, and the combined miR-34/315/305, miR-307 sites also exhibited partial silencing in the PNS but not in the CNS. This observation suggests that part of the reason for the complexity of miRNA binding sites in the nerfin-1 3'UTR could be due to tissue specificity of miRNA expression (Kuzin, 2007).

This study has examined the ability of the predicted miRNA binding sites within the Drosophila nerfin-1 3' UTR to silence mRNA translation in vivo. The principle finding of this study is that multiple miRNAs act cooperatively to regulate the spatial and temporal expression of Nerfin-1 in the developing embryonic nervous system. Indeed, no single miRNA-binding site is sufficient to recapitulate the endogenous post-transcriptional regulation in either the embryonic CNS or PNS. In the CNS, mRNA binding sites for multiple miRNAs are required to regulate the spatial expression of Nerfin-1 by silencing expression in all but the MP NBs. In the developing PNS, these studies indicate that miRNA mediated regulation does not restrict the onset of Nerfin-1 expression but rather it helps accelerate the rate of disappearance of Nerfin-1 in nascent neurons (Kuzin, 2007).

Whereas the whole 3' UTR was required for wild-type expression of nerfin-1, three individual sites had a partial effect of silencing in the CNS and four individual sites had only a partial effect in silencing in the PNS. The incomplete silencing in the CNS was stronger at a later stage of development than at an earlier stage, pointing to temporal effects of individual miRNAs. In two instances, partial silencing of nerfin-1 expression is accomplished by different sites in the CNS and PNS pointing to a potential tissue specificity of miRNA effects. miR-9A, miR-9B and miR-9C showed an effect in the CNS but not in the PNS, and, in contrast, the combined miR-34/315/305, miR-307 sites exhibited partial silencing in the PNS but not in the CNS. The same differential effect was observed for combined miR-305 and miR-13B binding sites. In addition, in the PNS, partial effects exhibited a degree of cell type specificity, suggesting that individual miRNAs exhibit cellular specificity even within a single tissue. The results suggest that the high number of conserved miRNA binding sites in the nerfin-1 3' RNA are likely to reflect differential temporal and spatial specificity of miRNA function. Further confirmation of this awaits in depth studies of the tissue specificity of miRNA expression (Kuzin, 2007).

CO₂ sensation represents an interesting example of nervous system and behavioral evolutionary divergence. The underlying molecular mechanisms, however, are not understood. Loss of microRNA-279 in Drosophila leads to the formation of a CO₂ sensory system partly similar to the one of mosquitoes. This study shows that a novel allele of the pleiotropic transcription factor Prospero resembles the miR-279 phenotype. A combination of genetics and in vitro and in vivo analysis was used to demonstrate that Pros participates in the regulation of miR-279 expression, and that reexpression of miR-279 rescues the pros CO₂ neuron phenotype. Common target molecules of miR-279 and Pros were identified in bioinformatics analysis, and it was shown that overexpression of the transcription factors Nerfin-1 and Escargot (Esg) is sufficient to induce formation of CO₂ neurons on maxillary palps. These results suggest that Prospero restricts CO₂ neuron formation indirectly via miR-279 and directly by repressing the shared target molecules, Nerfin-1 and Esg, during olfactory system development. Given the important role of Pros in differentiation of the nervous system, it is anticipated that miR-mediated signal tuning represents a powerful method for olfactory sensory system diversification during evolution (Hartl, 2011).

DEVELOPMENTAL BIOLOGY

Embryonic

The dynamics of nerfin-1 expression were assessed in embryos and in larval tissues by in situ hybridization. nerfin-1 transcript localizations were also sequentially followed with immunostaining for known neuronal precursor proteins to confirm the identity of nerfin-1 positive cells and to more accurately assess nerfin-1 expression dynamics during embryonic development. nerfin-1 expression is first detected in delaminating ventral cord neuroblasts (NBs) at late stage 7. However, the onset of nerfin-1 expression in the early delaminating NBs is not synchronous and the apparent levels of NB expression also vary. During early sublineage formation, nerfin-1 expression is detected in all Hunchback (Hb) immuno-positive NBs and in their first born GMCs, but no expression is detected in Hb positive neurons. During early CNS sublineage development, the apparent steady state levels of nerfin-1 expression varied among NBs. In situ signal intensity differences were observed between segmental homologue NBs and between different NBs (Stivers, 2000).

NB expression of nerfin-1 mRNA is transient. Starting at stage 9, there is a progressive loss of nerfin-1 in situ hybridization signal in both ventral cord and cephalic lobe NBs. Coincident with the loss of nerfin-1 NB expression is the onset of its expression in nascent GMCs. During the temporal phase of NB sublineage formation marked by castor (cas) expression, Cas positive NBs lack detectable nerfin-1 expression; however, their Cas positive GMCs express nerfin-1. nerfin-1 expression reaches its maximum during stages 11 though 12. However, starting at embryonic stage 13, there is a progressive decline in the number of nerfin-1 positive GMCs. This reduction in nerfin-1 expression correlates with the overall completion of embryonic NB lineage formation. nerfin-1 mRNA is also expressed in larval GMCs during adult CNS development. nerfin-2 spatial/temporal expression dynamics are different from those of nerfin-1; nerfin-2 transcripts were detected only in a subset of cephalic lobe neurons. No nerfin-2 expression was observed in the larval brain or imaginal discs (Stivers, 2000).

Nerfin-1 protein expression was studied using polyclonal antibodies raised against unique N- and C-terminal regions of the predicted 469 amino acid protein. The specificity of each antiserum was confirmed by the absence of Nerfin-1 immunostaining in embryos homozygous for nerfin-1^null mutations. During embryonic stages 7 through 9, Nerfin-1 encoding transcripts were found in all early delaminating ventral cord NBs, albeit at differing levels (Stivers, 2000). In marked contrast, immunostaining with both Nerfin-1-specific antisera identified only four ventral cord NBs per segment that expressed Nerfin-1 protein. These NBs, the unpaired midline MP1 and MP3 and the lateral MP2 pair, are unique: Unlike other ventral cord NBs, they do not undergo multiple asymmetric GMC producing divisions during CNS development but rather divide just once to generate interneurons. The identity of the MP2 NB as the sole Nerfin-1-positive lateral NB was established by first determining that one of its medial row NB neighbors, on its posterior flank, was the 5–2 NB; this identification was subsequently confirmed by co-nuclear localization of Nerfin-1 and the Prospero (Pros) homeodomain protein; except for its nuclear localization in the MP2, Pros is excluded from the nucleus in all other ventral cord lateral NBs. Following the MP2 NB division, Nerfin-1 was detected in both the vMP and dMP nascent interneurons. Shortly after the onset of Nerfin-1 expression in the MP2 NBs, the unpaired midline MP1 and MP3 NBs and their nascent neurons also transiently express Nerfin-1 (Kuzin, 2005).

By stage 12, nerfin-1 mRNA expression is activated in most newly formed CNS GMCs and nascent neurons (Stivers, 2000). This appears to be de novo activation of gene expression, since at stage 11, nerfin-1 mRNA is absent from NBs (Stivers, 2000). Nerfin-1 and Prospero protein co-localization studies revealed that many, but not all, Prospero-positive cells express Nerfin-1. By early stage 13, many newborn neurons during the initial phase of their axon development express Nerfin-1, as judged by double immunolabeling with anti-Nerfin-1 and the neuron-specific anti-Elav antibody. However, both nerfin-1 mRNA and protein expression in neurons is transient. Starting at late stage 13, there is a progressive reduction in the number of neurons that express nerfin-1 mRNA or protein, such that by late stage 14, only a small subset of cells throughout the CNS has detectable levels of expression (Kuzin, 2005).

In the developing PNS chordotonal and external sensory (ES) organs, Nerfin-1 is detected only transiently in nascent neurons. ES organs form via a stereotypic series of asymmetric divisions and each cell, precursor, or terminally differentiated cell, can be distinguished by a unique set of protein markers. Two ES organ precursors, the 2B and 3B, give rise, respectively, to the multidendritic (MD) and ES neuron. However, neither gives rise to neurons exclusively. Nerfin-1 is transiently expressed transiently in both MD and ES neurons but not in their precursors or in any other cell types in the ES organ lineage (Kuzin, 2005).

Although approximately a third of all early delaminating nerfin-1 mRNA-positive ventral cord NBs give rise to glia, albeit in varying numbers, Nerfin-1 protein was not detected in glia as judged by co-staining with Nerfin-1 and glial specific markers. In addition, no defects were identified in glial development due to the loss of nerfin-1 function, indicating that nerfin-1 is most likely required only for neuronal development and/or function. Taken together, this analysis of nerfin-1 mRNA and protein expression in the developing embryo reveals that while its message is expressed in many neural precursors and in many nascent neurons, its encoded protein is detected only transiently in a subset of young neurons and in those precursor cells that will undergo a single final division to generate neurons (Kuzin, 2005).

EFFECTS OF MUTATION

Loss-of-function nerfin-1 mutations were generated by the 'ends-in' homologous recombination gene knockout technique of Rong and Golik (2001). DNA sequence analysis of the targeted nerfin-1 locus, after the initial 'ends-in' homologous recombination event, revealed that one of the tandem copies of nerfin-1 had suffered a 593-bp deletion in the transcribed region. This deletion was most likely caused by exonuclease digestion of the targeting vector after the Sce1 endonuclease-induced double-stranded break but before its integration into the nerfin-1 chromosomal locus. Deletions covering the minimal promoter and 5′ transcribed leader sequence of both the Df(3L)nerfin-1⁵⁴ and Df(3L)nerfin-1¹⁵⁹ alleles (hereafter referred to as nerfin-1^null alleles) were detected after the allelic substitution step and were most likely the result of illegitimate recombination between micro-homologies present in the minimal promoter of one copy of the nerfin-1 duplication and the transcribed region of the tandem copy. Using conventional X-ray and di-epoxybutane mutagenesis procedures, additional nerfin-1 mutant alleles were generated from the mini-white gene tagged nerfin-1 locus obtained from the first phase of the knockout targeting technique. Genomic DNA PCR analysis of these larger deletions revealed that both the proximal promoter region and transcribed sequence of nerfin-1 were removed (Kuzin, 2005).

The targeted gene knockout and classical mutagenesis screens resulted in the isolation of five independent embryonic recessive lethal alleles. Although late-stage homozygous mutant embryos appeared normal, with no detectable gross morphological or segmentation defects, they failed to hatch from their egg chambers. Whole-mount Nerfin-1 immunostaining using both N- and C-terminal directed antisera and mRNA localization revealed that all of the alleles were embryonic nulls for nerfin-1 expression. To confirm that the lethality and cellular phenotype observed in the mutant embryos was due to the loss of nerfin-1, two independent 2nd chromosome P-element insertions that contained an 11,154 bp nerfin-1 genomic DNA fragment were used to rescue the viability and cellular phenotype and to restore the nerfin-1 wild-type expression level (Kuzin, 2005).

To determine if there was any alteration in either neural lineage development or whether the expression of a known neural- or glial-identity genes was altered in nerfin-1^null embryos, and the expression of 19 genes that have been demonstrated to play important roles in these early developmental events was examined. The analysis of all tested cell-identity markers revealed that the developmental processes that give rise to the correct numbers and identities of neurons and glia in both the CNS and PNS were not significantly affected by the loss of nerfin-1 function. For example, the spatial and temporal expression dynamics of Elav (neuronal) and Wrapper/Slit/Repo (glial) identity markers were not altered in nerfin-1^null embryos. In addition, expression of the transcription factors Hunchback, Kruppel, Pdm-1, Castor, Pros, Engrailed, Eve, and Odd-skipped were indistinguishable between wild-type and mutant embryos. Although the possibility that more subtle changes in neuronal identities have occurred as a result of loss of nerfin-1 cannot be ruled out, this analysis indicates that neurons and glia have not suffered major changes in their identities (Kuzin, 2005).

Given the absence of any detectable alteration in NB-lineage development in nerfin-1^null embryos, attempts were made to determine if Nerfin-1 played a more restricted role in neuronal maturation, such as axon outgrowth and/or pathfinding. To assess if axon patterning was altered in nerfin-1^null embryos, a battery of antibody markers was used to identify many axons or to decorate specific subsets of axons in the CNS and PNS. Immunostains of nerfin-1^null embryos revealed significant alterations in axon projections within the embryonic CNS but not in the PNS. For example, within the ventral nerve cord of stage 13 and older nerfin-1^null embryos, the longitudinal connective axon fascicles were disrupted between segments, and both the anterior and posterior commissures of each ventral cord ganglia were malformed. Axons that normally project through fascicles that make up the intersegmental longitudinal connectives appeared to either stall or randomly turn at or near segmental boundaries, creating disorganized tangles. In addition, the organization of longitudinal connectives within each of the segments was abnormal with misrouted axons projecting laterally away from the longitudinal tracks. Immunostains also revealed that the overall axon fascicle organization and apparent axon density of the ventral cord commissures was affected by the loss of nerfin-1 function. In addition, BP102 immunostaining of stage 14 and older embryos showed that the diameters of both the supra- and sub-esophageal commissures of the brain were significantly reduced in loss-of-function mutants. In stage 15 and older mutants, the medial, intermediate, and lateral Fasciclin2 (Fas2) positive longitudinal tracks were disrupted along the entire length of the ventral cord (Kuzin, 2005).

In contrast to the axon fascicle organization defects observed in the ventral cord and brain, no significant patterning defects were detected in the motoneuron nerve tracts that exit the CNS. In addition, the axon patterning of PNS neurons, outside the CNS, also appeared normal in nerfin-1^null embryos (Kuzin, 2005).

To better understand the axon misrouting in the CNS of nerfin-1^null embryos, analysis focused on the axonal development of three ventral cord neurons, the pCC interneuron, and the aCC and RP2 motoneurons. To accomplish this, a CD8GFP expressing Gal4/UAS transformant line was employed that prominently marks cell bodies and axons of these neurons (Fujioka, 2003). Nerfin-1 and Eve expression transiently overlap in these neurons, as judged by co-nuclear localization; however, Eve expression was not altered by loss of nerfin-1 (Kuzin, 2005).

In the absence of nerfin-1 function, significant patterning defects were observed in the pCC axons, which normally send their pioneering ipsilateral axons anteriorly to establish the medial fascicle of the longitudinal connective tracks. In stage 13 nerfin-1^null embryos, the pCC interneurons failed to send their axons anteriorly and instead projected their axons either in a lateral or posterior direction and many of the posterior projecting pCC axons crossed the ventral midline in adjacent posterior segments. By stage 14, all pCC interneurons in nerfin-1^null embryos had misguided axons and many of these axons had extensive side branches. In contrast, when compared to the significant axon misguidance phenotype of the pCC interneurons, the overall development and patterning of the aCC and RP2 motoneuron axon tracts did not appear to be adversely affected in nerfin-1^null embryos. For example, in nerfin-1^null embryos, the aCC and RP2 axons project to the dorsal muscle field, which contains the synaptic targets of these motoneurons. It should be noted that although nerfin-1 function does not appear to be required for these motoneurons to project their axons to the appropriate synaptic target field, the role of Nerfin-1 in synaptic target choice has not yet been fully assessed (Kuzin, 2005).

The transient nature of Nerfin-1 expression in nascent neurons suggests its role may be restricted to a specific phase of early axon guidance and that its presence in the nuclei of neurons undergoing subsequent phases of axon guidance and/or maturation may interfere with these processes. To determine the significance of the temporally restricted expression, the effects of Nerfin-1 misexpression outside of its normal wild-type expression boundaries was studied. Targeted misexpression of Nerfin-1 was accomplished by the Gal4-UAS system. Using different Gal4 driver lines (scabrous-, pros-, or castor-Gal4 to activate the expression of UAS-linked nerfin-1 during different stages of NB-lineage development, misexpression was observed not to alter neuronal or glial development nor did it affect axon fascicle patterning. In addition, the ectopic expression of Nerfin-1 in mesodermal-derived tissues, outside of the nervous system, via a twist-Gal4 driver, had no detectable effect on muscle development or embryonic viability (Kuzin, 2005).

However, prolonged/extended expression in neurons resulted in embryonic lethality and ventral cord axon fascicle patterning defects. Whole-mount immunostains of late stage 14 and older elav-Gal4/UAS-nerfin-1 embryos identified multiple defects in axon scaffolding throughout the CNS. Prolonged expression in neurons interfered with the development of Fas2-positive longitudinal connective fascicles. These experiments also revealed that Nerfin-1 misexpression had a differential effect on the organization of Fas2 positive axon fascicles, with the intermediate and lateral fascicles exhibiting a greater degree of defasciculation than the medial fascicle. Immunostains with antibodies specific for the different Robo family members also revealed that misexpression of Nerfin-1 in neurons affected the distribution of Robo3. Robo3 exhibited a wider more diffuse ventral cord distribution in elav-Gal4/UAS-nerfin-1 embryos, and it was found in axons extending across the midline, suggesting either that the subcellular distribution of Robo3 had been altered or that axons within the Robo3-positive axons had defasciculated from the connectives and crossed the midline. Interestingly, no significant effect on the other two Robos, Robo and Robo2, were observed in elav-Gal4/UAS-nerfin-1 embryos. In addition, no significant changes in the expression of other axon guidance genes or cell-fate determinants were detected in elav-Gal4/UAS-nerfin-1 embryos. Prolonged misexpression did not significantly alter the patterning of motoneuron axon tracks that exit the CNS nor did it adversely affect axon patterning in the PNS (Kuzin, 2005).

Nerfin was identified in a genome-wide analyses for transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites

Dendrite arborization patterns are critical determinants of neuronal function. To explore the basis of transcriptional regulation in dendrite pattern formation, RNA interference (RNAi) was used to screen 730 transcriptional regulators and 78 genes involved in patterning the stereotyped dendritic arbors of class I da neurons were identified in Drosophila. Most of these transcriptional regulators affect dendrite morphology without altering the number of class I dendrite arborization (da) neurons and fall primarily into three groups. Group A genes control both primary dendrite extension and lateral branching, hence the overall dendritic field. Nineteen genes within group A act to increase arborization, whereas 20 other genes restrict dendritic coverage. Group B genes appear to balance dendritic outgrowth and branching. Nineteen group B genes function to promote branching rather than outgrowth, and two others have the opposite effects. Finally, 10 group C genes are critical for the routing of the dendritic arbors of individual class I da neurons. Thus, multiple genetic programs operate to calibrate dendritic coverage, to coordinate the elaboration of primary versus secondary branches, and to lay out these dendritic branches in the proper orientation (Parrish, 2006; Full text of article).

To assay for the stereotyped dendrite arborization pattern of class I da neurons (hereafter referred to as class I neurons) in RNAi-based analysis of dendrite development, a Gal4 enhancer trap line (Gal4²²¹) was used that is highly expressed in class I neurons and weakly expressed in class IV neurons during embryogenesis. Because of the simple and stereotyped dendritic arborization patterns of the dorsally located ddaD and ddaE, the studies of dendrite development focused on these two dorsally located class I neurons (Parrish, 2006).

To establish that RNAi is an efficient method to systematically study dendrite development in the Drosophila embryonic PNS, it was demonstrated that injecting embryos with double-stranded RNA (dsRNA) for green fluorescent protein (gfp) is sufficient to attenuate Gal-4²²¹-driven expression of an mCD8::GFP fusion protein as measured by confocal microscopy. Next whether RNAi could efficiently phenocopy loss-of-function mutants known to affect dendrite development was tested. Similar to the mutant phenotype of short stop (shot), which encodes an actin/microtubule cross-linking protein, shot(RNAi) caused routing defects, dorsal overextension, and a reduction in lateral branching of dorsally extended primary dendrites. Likewise, RNAi of sequoia or flamingo resulted in overextension of ddaD and ddaE, RNAi of hamlet resulted in supernumerary class I neurons, and RNAi of tumbleweed resulted in supernumerary class I neurons and a range of arborization defects, consistent with the reported mutant phenotypes. Thus, RNAi is effective in generating reduction of function phenotypes in embryonic class I dendrites (Parrish, 2006).

In contrast to the genes that coordinately affect dorsal dendrite outgrowth and lateral branching/outgrowth, a group of 21 genes (group B) were identified that have opposing effects on dendrite outgrowth and branching, suggesting that dendrite outgrowth and branching might partially antagonize one another. RNAi of 19 of these genes resulted in dorsal overextension of primary dendrites and a reduction in lateral branching/lateral branch extension. In the most severe cases, such as RNAi of the transcriptional repressor snail, dorsal overextension of almost completely unbranched dendrites was found. Like snail(RNAi), RNAi of the nuclear hormone receptor knirps, the transcriptional repressor l(3)mbt, as well as 15 other genes, all caused dorsal overextension of primary dendrites. As in the case of genes that normally limit arborization, RNAi of these genes rarely caused dendrites to cross the dorsal midline (Parrish, 2006).

RNAi of several genes affected the number of class I neurons as well as morphogenesis of class I dendrites; RNAi of seven genes caused supernumerary cells and RNAi of four genes caused high penetrance cell loss in addition to dendrite defects. For example, RNAi of the zinc finger TF nerfin-1 caused an increase in neurons labeled by Gal4²²¹ with as many as eight neurons visible in some segments. Unlike wild-type class I neurons, neurons from nerfin-1(RNAi)-treated embryos extended mostly unbranched dendrites. In many cases, the routing pattern of the dendrites appeared abnormal, but the cell number defects make it difficult to resolve the projection pattern of individual dendrites or conclusively determine whether each neuron projects the same number of primary dendrites. RNAi of six other genes, including jumeau, a winged-helix TF known to regulate neuroblast cell fate and the number of PNS neurons, similarly caused an increase in neuronal number as well as defects in dendrite morphogenesis (Parrish, 2006).

Six touch receptor neurons with distinctive morphological features sense gentle touch in Caenorhabditis elegans. Previous studies have identified three genes (lin-32, unc-86 and mec-3) that regulate touch cell development. However, since other cell types also require these genes, it is suspected that other genes help restrict the expression of touch cell characteristics to the six neurons seen in the wild type. To identify such genes, mutants defective in genes required for the development of other C. elegans cells were examined for changes in the pattern of touch cell-specific features. Mutations in seven genes either reduce (lin-14) or increase (lin-4, egl-44, egl-46, sem-4, ced-3 and ced-4) the number of touch receptor-like cells. The combinatorial action of these genes, all of which are required for the production of many cell types, restrict the number of cells expressing touch receptor characteristics in wild-type animals by acting as positive and negative regulators and by removing cells by programmed cell death (Mitani, 1993).

Inhibition of touch cell fate by egl-44 and egl-46 in C. elegans

In wild-type Caenorhabditis elegans, six cells develop as receptors for gentle touch. In egl-44 (Drosophila homolog: Scalloped) and egl-46 (Drosophila homologs: Nerfin I and II) mutants, two other neurons, the FLP cells, express touch receptor-like features. The FLP cells normally express lin-14 as well as unc-86 (Drosophila homolog ACJ6/IPOU and mec-3 that code for a LIM homeodomain transcription factor). These cells do not express touch cell characteristics because of the action of two genes, egl-44 and egl-46. Mutation of either egl gene results in a transformation of the FLP cells into cells that resemble the touch cells. Instead of differentiating as FLP neurons, the cells in the mutants express the mec-4 and mec-7 touch function genes and have processes that lie adjacent to the normal touch cell processes and that also have the large-diameter microtubules and extracellular matrix characteristic of the touch cells. egl-44 and egl-46 also affect the differentiation of other neurons, including the HSN neurons, two cells needed for egg laying (Wu, 2001).

The egl-44 gene encodes a putative transcription regulatory protein of 471 amino acids similar to transcription enhancer factor (TEF) proteins. TEF-1-like proteins, which have been found from yeast to humans, are involved in a variety of developmental processes. For example, mutations in the Drosophila TEF gene scalloped affect the development of sensory bristles and central neurons needed for taste, and human TEF-5 is expressed in the placenta and activates the chorionic somatomammotropin gene. The most conserved region among family members is the 70-amino-acid TEA/ATTS DNA-binding domain at the N terminus. EGL-44, the Drosophila TEF Scalloped (Sd), and the human TEF-5 protein (the human TEF most similar to EGL-44) are 82% identical in the TEA/ATTS DNA-binding domain. The egl-44 mutations are in this domain. The C-terminal half of EGL-44, Sd, and TEF-5 are also 47% identical, and this region in TEF-1 contains Pro-rich, STY-rich, and other sequences that are needed together for transcriptional activation. Although EGL-44 does not contain sequences that match the activation domains in other TEF proteins, its C-terminal half is rich in Pro, Ser, Thr, and Tyr (Wu, 2001).

egl-46 encodes a predicted protein of 286 amino acids. The most notable features of EGL-46 are three closely spaced zinc finger motifs in the C-terminal region of EGL-46. The first two zinc finger motifs are separated by 9 amino acids and may form a pair, and the third motif is 19 amino acids C-terminal to the first two. The second finger motif of EGL-46 conforms to the TFIIIA (C2H2) consensus, whereas the other two fingers differ slightly. In the first and third fingers, the last His is replaced by Cys; in the first finger, the spacing between the His and the last Cys residue differs from the consensus. Nonetheless, the overall spacing and the conservation of other residues indicate that these are variants of the TFIIIA type. These three zinc fingers may mediate DNA binding by EGL-46. Consistent with a role in the nucleus, EGL-46 contains a potential nuclear localization signal (amino acids 110-126). Also consistent with a role as a transcription factor, EGL-46 contains a glutamine-rich region (amino acids 61-75), which may act as a transcriptional activation domain. EGL-46 and several proteins with which it shares similarity appear to form a new family of zinc finger proteins. These proteins include the human and mouse IA-1 proteins, the mouse MLT-1 protein, a human protein tentatively named R-355C3p, and two proteins from Drosophila melanogaster, Nerfin-1 and Nerfin-2 (Stivers, 2000). No other closely similar sequences are found in the C. elegans genome. All seven proteins have three zinc finger regions; the mammalian proteins have two additional zinc finger sequences C-terminal to these three. The first two zinc fingers show considerable similarity and equal spacing in all seven proteins. The second zinc finger of the pair is 90% identical for all the proteins and has a conserved potential PKC phosphorylation site. The high degree of similarity in this zinc finger pair region indicates that the region is functionally important. The egl-46(n1127) mutation produces a Cys to Phe substitution in the first zinc finger of this pair. All seven proteins share an additional region of similarity N-terminal to the zinc fingers (26 amino acids in EGL-46) that contains a potential nuclear localization signal. N-terminal to this region, all seven proteins have regions that are proline-rich (although EGL-46 is less so than the others). The mammalian proteins also contain a short transcriptional repression domain, but this sequence is not conserved in EGL-46 or the Drosophila proteins (Wu, 2001).

Two features of egl-46 indicate that its product may be regulated posttranscriptionally: (1) the N-terminal region of the protein contains a 25-amino-acid putative PEST sequence that could target the protein for rapid degradation; (2) the egl-46 mRNA 3' UTR contains sequences that may target the mRNA for degradation. The 3' UTR contains three AUUUA motifs, which have been associated with RNA instability. More recent work, however, has found that a single AUUUA motif is not sufficient to cause mRNA instability and that a UUAUUUA(U/A)(U/A) sequence may be required. egl-46 has the core of this sequence, UAUUUAU, which when tested in three copies promoted mRNA degradation. Several other members of this gene family share these features. The Nerfin-1 (but not Nerfin-2), hIA-1 (but not mIA-1), MLT 1, and R-355C3p proteins have predicted PEST sequences. Nerfin-1, hIA-1, and mlt 1 mRNAs contain AUUUA repeats in their 3' UTRs. Little is known about the EGL-46-related proteins, although they are often found in neuronal tissues, and at least Nerfin-1 and IA-1 are found in dividing neural precursors. Of the Drosophila proteins, Nerfin-1 is distributed widely throughout the nervous system and is observed in many neuronal precursors; Nerfin-2 is found in only a few neurons (Stivers, 2000). The human IA-1 protein is found in many neuroendocrine tumor cell lines and virtually all small cell lung cancer cell lines. The mouse protein MLT 1 has been identified in brain and kidney (Wu, 2001).

Both egl-44 and egl-46 are expressed in FLP and HSN neurons (and other cells); expression of egl-46 is dependent on egl-44 in the FLP cells but not in the HSN cells. Wild-type touch cells express egl-46 but not egl-44. Moreover, ectopic expression of egl-44 in the touch cells prevents touch cell differentiation in an egl-46-dependent manner. The sequences of these genes and their nuclear location as seen with GFP fusions indicate that they repress transcription of touch cell characteristics in the FLP cells (Wu, 2001).

egl-44 appears to repress the expression of touch cell features in the FLP cells in two ways: (1) egl-44 is required for the wild-type levels of egl-46 expression in these neurons; (2) egl-44 must be expressed with egl-46 to repress touch cell differentiation. This conclusion is supported by the ectopic expression of these genes in the touch cells and by the finding that these cells normally express egl-46. (The expression of egl-46 in the touch cells may account for the minor touch cell process and morphological defects in egl-46 mutants. EGL-44 may interact directly with EGL-46, because TEF proteins in other organisms act as transcription cofactors (Wu, 2001).

These considerations extend the model of combinatorial control of touch cell development. In the six touch cells, unc-86 promotes mec-3 expression, and the UNC-86/MEC-3 heterodimer activates the expression of touch genes. In the FLP neurons, egl-44 promotes egl-46 expression, presumably with some other factor(s), and EGL-44 and EGL-46 together, presumably also with some other factor(s), inhibit touch gene expression to secure the normal differentiation of FLP neurons. Because mec-3 and unc-86 are expressed in FLP cells normally, it is possible that EGL-44 and EGL-46 repress touch cell fate by directly antagonizing activation by MEC-3 or/and UNC-86 (Wu, 2001).

Although both egl-44 and egl-46 are expressed in the HSN neurons, and expression of the wild-type genes in the HSN cells complements egl-44 and egl-46 mutations, the timing of their expression is unexpected given the phenotypes of the mutant cells. egl-44 and egl-46 mutations affect HSN differentiation in three ways: (1) the cells migrate further than wild-type cells; (2) their axons are misdirected, and (3) they have reduced production of the neurotransmitter serotonin. Of these three processes, only cell migration occurs in the embryos; the others arise as the animals become adults. In contrast, the HSN cells express egl-44 in the embryo and express egl-46 in the embryo and transiently and weakly in L2 larvae. The embryonic expression could underlie a role for these genes in the regulation of HSN migration. The expression pattern of these genes is less easily reconciled with the late larval outgrowth defects and adult serotonin defect (both of which are incompletely penetrant). One explanation is that these genes act early to establish the ability of the cells to generate serotonin or grow appropriately. If so, the genes could act indirectly within the HSN to influence these later traits. It has been suggested, for example, that interactions of the HSN cells with their muscle targets result in the lowered levels of serotonin in the mutant HSN cells. An early defect in the HSN cells could lead to these abnormal interactions. Alternatively, because the genes are expressed in many other cells, their influence on axonal outgrowth and/or serotonin production could be caused by the loss of gene activity in other cells; for example, some of the HSN phenotypes are not the result of the cell-autonomous action of the genes. The AVM and PVM touch cells also have a low penetrant outgrowth defect in egl-44 and egl-46 animals, but the cells do not detectably express egl-44. Perhaps the loss of egl-44 expression in the hypodermis underlies the touch cell and HSN outgrowth defects (Wu, 2001).

Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior

Caenorhabditis elegans polycystins LOV-1 and PKD-2 are expressed in the male-specific HOB neuron, and are necessary for sensation of the hermaphrodite vulva during mating. Male vulva location behavior and expression of lov-1 and pkd-2 in the ciliated sensory neuron HOB require the activities of transcription factor EGL-46 and to some extent also EGL-44. This EGL-46- regulated program is specific to HOB and is distinct from a general ciliogenic pathway functioning in all ciliated neurons. The ciliogenic pathway regulator DAF-19 affects downstream components of the HOB-specific program indirectly and is independent of EGL-46 activity. The sensory function of HOB requires the combined action of these two distinct regulatory pathways (Yu, 2003).

Because of its simple nervous system with invariant cell lineage and position, C. elegans provides an excellent model to study how diverse neuronal subtypes are specified. The anatomy and interconnectivity of all 118 hermaphrodite neuron types are known, as are the molecular details of many neuronal subtypes. The C. elegans male has 79 additional neurons, falling into 37 classes. Most of those male-specific neurons are located in the tail region and contribute to specific motor output during mating behavior (Yu, 2003).

During mating, the C. elegans male scans for the vulva by touching the hermaphrodite with the ventral side of his tail and backing along her body. If the vulva is not found, he turns at the hermaphrodite head or tail and scans the other side. The male hook sensillum is a copulatory structure that is located just anterior to the cloaca and mediates vulval location behavior. Intact wild-type males usually stop at their first or second vulval encounter. When the hook sensillum is ablated, operated males circle the hermaphrodite multiple times and fail to stop at the vulva. This defect is referred to as the Lov (location of the vulva defective) phenotype. The hook sensillum consists of five cells, including a structural cell and two ciliated sensory neurons HOA and HOB. The two hook neurons have large nuclei and send dendrites into the hook structure; however, their anatomy can be distinguished by cell morphology and synaptic contacts. Ablation of either HOA or HOB results in a Lov phenotype, indicating that HOA and HOB have non-redundant functions (Yu, 2003).

The C. elegans homologues of human autosomal dominant polycystic kidney disease genes PKD1 (lov-1) and PKD2 (pkd-2) are expressed in the HOB hook neuron. Human PKD genes, which encode divergent members of the TRP family of cation channels, possibly act in signal transduction important for renal epithelial differentiation, because mutations in PKD1 and PKD2 are associated with pathogenic renal cyst formation. In C. elegans, lov-1 and pkd-2 mutations disrupt vulva location behavior, consistent with a defect in HOB sensory function. Although LOV-1 and PKD-2 are localized in sensory cilia and cell bodies, the ultrastructure of cilia and dendrites appears normal in lov-1 and pkd-2 mutants (Yu, 2003).

Another class of genes required for vulva location affects the formation of ciliated endings in sensory neurons. This class includes che-3, daf-10, osm-5 and osm-6. che-3, osm-5 and osm-6 are required for most or all sensory cilia, while daf-10 functions only in a subset of ciliated sensory neurons. The hermaphrodite expression of osm-5, a homolog of the mouse autosomal recessive polycystic kidney disease (ARPKD) gene, and osm-6 has been shown to be regulated by a RFX transcription factor DAF-19, which plays a critical role in general sensory cilium differentiation (Yu, 2003).

An allele of egl-46, a putative zinc-finger transcription factor, was isolated in a screen for loci required for fate specification of C. elegans hook neuron HOB. egl-46 has been characterized as a gene, which, when mutated, affects the development of two mechanosensory neurons (FLP cells), as well as having defects in the hermaphrodite HSN egg-laying motoneurons (Desai, 1988; Desai and Horvitz, 1989). EGL-46 and the transcription enhancer factor (TEF) homolog EGL-44 (Drosophila homolog Scalloped) are expressed in the HOB hook neuron and are required for expression of genes encoding polycystins LOV-1 and PKD-2, homeodomain protein CEH-26, and neuropeptide-like protein NLP-8. egl-44 and egl-46 mutants are defective in vulva location behavior during mating, suggesting compromised normal HOB function. This HOB-specific pathway is distinct from the DAF-19-regulated general cilia formation pathway in sensory neurons. daf-19 acts independently of egl-44 and egl-46 to affect expression of downstream genes in the HOB-specific program, indicating that general and cell-specific regulatory factors work in concert to establish cell-specific features crucial for HOB neuronal function in sensory behavior (Yu, 2003).

To fulfill its sensory function, the HOB neuron must build specific structures and express appropriate molecules to receive and transduce signals. In a proposed model, the general cilium formation pathway governed by daf-19 programs HOB to have sensory cilia, and egl-46, partly with egl-44, regulates expression of genes in HOB involved in signal transduction cascades. These two pathways are distinct. Formation of the cilium structures is not necessary for HOB-specific gene expression, and regulators in the cell-specific pathway, egl-44 and egl-46, showed no obvious effect on the HOB expression of the cilium structure genes osm-5 and osm-6. However, these two pathways do interact: not only are they both necessary for HOB function, but the ciliogenic pathway regulator daf-19 has an effect on downstream components of the HOB-specific program without affecting egl-44 or egl-46 expression (Yu, 2003).

Previous studies have suggested that daf-19 is only required for genes functioning in common aspects of cilium formation. This study provides the first evidence that daf-19 is required for the expression of some cell-type-specific factors. It is proposed that daf-19 acts through some unknown factor(s) [which could be an X-box containing gene(s)] to modify HOB-specific gene expression. Stronger daf-19::gfp expression is observed in HOB than in HOA, but whether it is associated with additional daf-19 regulation of HOB-specific gene expression is not known. This daf-19 regulation is not limited to the HOB neuron as daf-19 also affects pkd-2 expression in the ray neurons and CEM neurons, indicating some general features are common in this subtype of ciliated sensory neurons. Coupled regulation of general neuronal features and cell-specific identities by multiple transcriptional factors has been found in several different organisms, such as specification of the C. elegans AIY interneuron, C. elegans olfactory neurons and vertebrate motoneurons, and thus might be a general aspect of the logic of neuronal cell type specification (Yu, 2003).

Both male hook neurons, HOA and HOB, play a role in vulva location behavior. They both detect the presence of a hermaphrodite vulva, and then produce a distinctive output. This output causes the male to stop at the vulva and to proceed to the next step of mating. One possible explanation for the functional non-redundancy of HOA and HOB is that they possess different sensory specificity, and hence respond to different cues from the vulva. Another possibility is HOA and HOB might receive the same cues at different times. egl-44 is broadly expressed in many cells of the male tail, but its expression is almost undetectable in HOA. None of the other genes, including egl-46 and its downstream targets in the HOB-specific program described in this study, is expressed in HOA. The unequal expression of those genes in the two hook neurons provides molecular evidence supporting distinct roles for HOA and HOB in mating (Yu, 2003).

egl-46 mutations result in an extra cell division in the terminal differentiation of the C. elegans Q neuroblast lineage (Desai, 1989). Loss of either egl-44 or egl-46 function does not cause a cell division defect or a failure in establishment of primary ciliated neural fate during HOB specification. This was determined by anatomical examination and by expression of the cilium structure genes, osm-5 and osm-6. In the non-sex-specific FLP cells, it has been shown that egl-44 and egl-46 act as transcriptional repressors (Wu, 2001). They promote the correct subtype of mechanosensory neurons by suppressing expression of genes dedicated to another subtype. Possible positive roles in gene transcription are implicated for egl-44 and egl-46 in the HSN neurons, but no target has been identified (Desai, 1989; Wu, 2001). These data suggest a positive effect of egl-44 and egl-46 on the expression of downstream HOB-specific genes. However, it has not been ruled out that EGL-44 and EGL-46 activate gene expression in HOB by repression of a repressor of HOB-specific genes (Yu, 2003).

It is proposed that the sensory abilities of the HOB neuron are established by individual cell-specific components regulated by egl-44 and egl-46. One of these components, ceh-26, is the C. elegans ortholog of Drosophila prospero (pros) gene. pros is involved in the initiation of differentiation in specific neurons following asymmetric cell division. However, expression of ceh-26 in HOB is not coupled with cell division. Instead, it is expressed at a much later stage, after basic features of cell fate have been established. Similar to HOB, ray B neurons express both egl-44 and egl-46, but unlike HOB, these neurons do not express ceh-26::gfp. Therefore, it is thought that co-expression of egl-44 and egl-46 is not sufficient to activate ceh-26::gfp in HOB and additional co-factors are also required. The other downstream components, lov-1, pkd-2 and nlp-8, encode proteins that are probably involved in HOB sensory input and output. LOV-1 and PKD-2 accumulate in the sensory cilia and have been proposed to act in a complex; a working model is that LOV-1 is a sensory receptor and PKD-2 is a channel protein. Neuropeptide-like protein NLP-8 might act as a neurotransmitter or neuromodulator released by HOB to mediate the response to the stimuli from the hermaphrodite vulva (Yu, 2003).

Potential mechanosensory and chemosensory interactions between the male and the hermaphrodite during mating is implied by the vulva location behavior itself, as well as by the requirement of functional ciliated sensory endings in the two hook neurons. Whether HOB is a mechanical sensor or a chemical sensor or both, as is the case for the polymodal ASH neuron, is not known. Because egl-44 and egl-46 distinguish between mechanosensory neuron subtypes during FLP fate specification, it is possible that these two genes regulate downstream targets that confer mechanosensory ability to the HOB neuron. If so, as members of TRP protein gene family, lov-1 and pkd-2 might be such targets. Known examples of TRP proteins that play a role in mechanotransduction include a C. elegans TRP protein OSM-9 and the Drosophila TRP-like NOMPC protein. Both of these TRP proteins are expressed in mechanosensory neurons and are involved in mechanosensory response (Yu, 2003).

Human PKD1 and PKD2 were identified as two loci responsible for the autosomal dominant polycystic kidney disease (ADPKD), a genetic disorder that causes renal failure at various ages of adulthood. Relatively little is known about the regulation of these PKD genes and possible alterations during the disease process. Expression of C. elegans PKD gene homologs, lov-1 and pkd-2, is affected by transcription factors egl-44 and egl-46. The mammalian TEF proteins, homologous to egl-44, have been implicated in multiple developmental processes. Specific expression in kidney was reported for multiple members of TEF proteins. C. elegans EGL-46 belongs to a novel zinc-finger protein subfamily. Identified close mammalian homologs of egl-46 includes insulinoma associated (IA) proteins, implicated in islet differentiation of the pancreas, and murine MLT 1 protein, silenced in the liver tumors, but their possible roles in the kidney have not been investigated. Progressive cyst formation in ADPKD is not restricted to kidney: involvement of the liver and the pancreas occurs, indicating that those organs suffer similar pathogenesis during progression of the disease. The demonstrated gene regulation network in HOB might reveal important insights into the regulation of human polycystin gene expression (Yu, 2003).

The dependence of ciliogenesis for the function of PKD-2 may be even more relevant to renal development in mammals. In C. elegans, the ARPKD homolog osm-5 is a direct target of the RFX factor DAF-19, making the requirement of DAF-19 activity for pkd-2 expression particularly interesting with regard to the link between ADPKD and ARPKD. Mammalian polycystins and the cilia of the kidney cells might participate in a common signaling pathway crucial for renal differentiation and function. This hypothesis implies that RFX factor(s) might play a role in the renal development (Yu, 2003).

Developmental stage-dependent transcriptional regulatory pathways control neuroblast lineage progression

Neuroblasts generate neurons with different functions by asymmetric cell division, cell cycle exit and differentiation. The underlying transcriptional regulatory pathways remain elusive. Genetic screens were performed in C. elegans, and three evolutionarily conserved transcription factors (TFs) essential for Q neuroblast lineage progression were identified. Through live cell imaging and genetic analysis, it was shown that the storkhead TF HAM-1 regulates spindle positioning and myosin polarization during asymmetric cell division and that the PAR-1-like kinase PIG-1 is a transcriptional regulatory target of HAM-1. The TEAD TF EGL-44, in a physical association with the zinc-finger TF EGL-46, instructs cell cycle exit after the terminal division. Finally, the Sox domain TF EGL-13 is necessary and sufficient to establish the correct neuronal fate. Genetic analysis further demonstrated that HAM-1, EGL-44/EGL-46 and EGL-13 form three transcriptional regulatory pathways. This study has thus identified TFs that function at distinct developmental stages to ensure appropriate neuroblast lineage progression and suggest that their vertebrate homologs might similarly regulate neural development (Feng, 2013).

IA-1, structural homolog of Nerfin-1 and EGL-46 in mammals

A subtraction library was constructed from human insulinoma (beta cell tumor) and glucagonoma (alpha cell tumor) cDNA phagemid libraries. Differential screening of 153 clones with end-labeled mRNAs from insulinoma, glucagonoma, and HeLa cells resulted in the isolation of a novel cDNA clone designated IA-1. This cDNA clone has a 2838-base pair sequence consisting of an open reading frame of 1530 nucleotides, which translates into a protein of 510 amino acids with a pI value of 9.1 and a molecular mass of 52,923 daltons. At the 3'-untranslated region there are seven ATTTA sequences between two polyadenylation signals (AATAAA). The IA-1 protein can be divided into two domains based upon the features of its amino acid sequence. The NH2-terminal domain of the deduced protein sequence (amino acids 1-250) has four classical pro-hormone dibasic conversion sites and an amidation signal sequence, Pro-Gly-Lys-Arg. The COOH-terminal domain (amino acids 251-510) contains five putative 'zinc-finger' DNA-binding motifs of the form X3-Cys-X2-4-Cys-X12-His-X3-4-His-X4 which has been described as a consensus sequence for members of the Cys2-His2 DNA-binding protein class. Northern blot analysis revealed IA-1 mRNA in five of five human insulinoma and three of three murine insulinoma cell lines. Expression of this gene was undetectable in normal tissues. Additional tissue studies have revealed that the message is expressed in several tumor cell lines of neuroendocrine origin including pheochromocytoma, medullary thyroid carcinoma, insulinoma, pituitary tumor, and small cell lung carcinoma. The restricted tissue distribution and unique sequence motifs suggest that this novel cDNA clone may encode a protein associated with the transformation of neuroendocrine cells (Goto, 1992).

IA-1 is a novel cDNA originally isolated from a human insulinoma subtraction library (ISL-153). It encodes a protein containing both a zinc finger DNA-binding domain and a putative prohormone domain. IA-1 transcripts have been found thus far only in tumors of neuroendocrine origin. Clinical studies have shown that IA-1 is a sensitive marker for neuroendocrine differentiation of human lung tumors. The entire IA-1 gene and its 5'-upstream region have been cloned and sequenced from a human liver genomic library. In situ hybridization localized the IA-1 gene to the short arm of human chromosome 20. Sequence analysis and restriction enzyme mapping showed that the IA-1 gene is uninterrupted and appears to be intronless. Evidence that IA-1 is an intronless gene that can translate into protein was obtained from in vitro translation studies that showed that both IA-1 cDNA and IA-1 genomic DNA yielded identical protein products of approximately 61,000 daltons. Examination of the 5' upstream region (2090 base pairs) revealed several tissue-specific regulatory elements, including glucokinase upstream promoter elements and a Pit-1 factor binding site. The presence of several different upstream regulatory elements may account for IA-1 gene expression in different neuroendocrine tumors (Lan, 1994).

IA-1 is a novel zinc finger transcription factor with a restricted tissue distribution in the embryonic nervous system and tumors of neuroendocrine origin. The 1.7-kilobase 5'-upstream DNA sequence of the human IA-1 gene directs transgene expression predominantly in the developing nervous system including forebrain, midbrain, hindbrain, spinal cord, retina, olfactory bulb, and cerebellum; this pattern recapitulates the expression patterns of neuroendocrine tissues and childhood brain tumors. The IA-1 promoter deletion reporter gene constructs revealed that the sequence between -426 and -65 bp containing three putative E-boxes (~361 bp) upstream of the transcription start site is sufficient to confer tissue-specific transcriptional activity. Further mutation analysis revealed that the proximal E-box (E3) closest to the start site is critical to confer transcriptional activity. Electrophoretic mobility shift assay and transient transfection studies demonstrated that the NeuroD1 and E47 heterodimer are the key transcription factors that regulate the proximal E-box of the IA-1 promoter. Therefore, it is concluded that the IA-1 gene is developmentally expressed in the nervous system and the NeuroD1/E47 transcription factors up-regulate IA-1 gene expression through the proximal E-box element of the IA-1 promoter (Breslin, 2001).

A novel cDNA, insulinoma-associated antigen-1 (IA-1), containing five zinc-finger DNA-binding motifs, was isolated from a human insulinoma subtraction library. IA-1 expression is restricted to fetal but not adult pancreatic and brain tissues as well as tumors of neuroendocrine origin. Using various GAL4 DNA binding domain (DBD)/IA-1 fusion protein constructs, it was demonstrated that IA-1 functions as a transcriptional repressor and that the region between amino acids 168 and 263 contains the majority of the repressor activity. Using a selected and amplified random oligonucleotide binding assay and bacterially expressed GST-IA-1DBD fusion protein (257-510 a.a.), the consensus IA-1 binding sequence, TG/TC/TC/TT/AGGGGG/TCG/A, was identified. Further experiments showed that zinc-fingers 2 and 3 of IA-1 are sufficient to demonstrate transcriptional activity using an IA-1 consensus site containing a reporter construct. A database search with the consensus IA-1 binding sequence revealed target sites in a number of pancreas- and brain-specific genes consistent with its restricted expression pattern. The most significant matches were for the 5'-flanking regions of IA-1 and NeuroD/beta2 genes. Co-transfection of cells with either the full-length IA-1 or hEgr-1AD/IA-1DBD construct and IA-1 or NeuroD/beta2 promoter/CAT construct modulated CAT activity. These findings suggest that the IA-1 protein may be auto-regulated and play a role in pancreas and neuronal development, specifically in the regulation of the NeuroD/beta2 gene (Breslin, 2002).

The isolation and characterization has been described of the mouse homolog of the human zinc-finger transcription factor INSM1 (IA-1), and an interacting protein was identified. A 2.9-kb cDNA with an open reading frame of 1563 nucleotides, corresponding to a translated protein of 521 amino acids, was isolated from a mouse beta TC-1 cDNA library. Mouse INSM1 was found to be 86% identical to human INSM1 and both proteins contain proline-rich regions and multiple zinc-finger DNA-binding motifs. Sequencing of mouse Insm1 genomic DNA revealed that it is an intronless gene. Chromosomal mapping localized Insm1 to chromosome 2. Northern blot analysis showed that mouse Insm1 expression begins at 10.5 days in the embryo, decreases after 13.5 days, and is barely detected at 18.5 days. In mouse brain, Insm1 is strongly expressed for 2 weeks after birth but shows little or no expression thereafter. Transfection of cells with GFP-tagged INSM1 revealed that INSM1 is expressed exclusively in the nucleus. Proteins that interacted with INSM1 were identified by the yeast two-hybrid system and the binding of one of them, Cbl-associated protein (CAP), to INSM1 was confirmed by in vitro pull-down experiments, nuclear colocalization, and co-immunoprecipitation assays. Further studies showed that both INSM1 and CAP proteins were present in the nucleus of insulinoma cells and that endogenous INSM1 protein was co-precipitated with antibody to CAP. These findings raise the possibility that during embryo development CAP may enter the nucleus through its own nuclear localization signal or by binding to INSM1 (Xie, 2002).

The restriction of IA-1 gene expression in human fetal pancreata of different gestational stages was analyzed along with whether the expression of IA-1 gene is associated with rat AR42J cell differentiation into insulin-positive cells. To examine whether the IA-1 gene is associated with pancreatic endocrine cell differentiation, a rat pancreatic amphicrine cell line, AR42J, was used to investigate whether the expression of the IA-1 gene coincides with AR42J cells converting into either endocrine or exocrine lineage. A set of islet transcription factors was also analyzed that regulate key differentiation steps involved in activating the genes that confer the specialized functions of terminally differentiated pancreatic islet cells. When the AR42J cells were converted into insulin-positive cells induced by GLP-1, insulinoma conditioned-medium, or both, a significant elevated expression of mRNA for IA-1 and islet-specific transcription factors such as Pdx-1, NeuroD/beta2, and Nkx6.1 was observed. In contrast, dramatically decreased expression of mRNA for IA-1 and islet-specific transcription factors was displayed when AR42J cells were converted into the acinar-like phenotype by dexamethasone. It is concluded that the IA-1 gene is developmentally regulated in fetal pancreatic cells, and its expression pattern is consistent with parallel changes in islet-specific transcription factors during the endocrine differentiation of AR42J cells (Zhu, 2002).

Insm1 controls development of pituitary endocrine cells and requires a SNAG domain for function and for recruitment of histone-modifying factors

The Insm1 gene encodes a zinc finger factor expressed in many endocrine organs. This study shows that Insm1 is required for differentiation of all endocrine cells in the pituitary. Thus, in Insm1 mutant mice, hormones characteristic of the different pituitary cell types (thyroid-stimulating hormone, follicle-stimulating hormone, melanocyte-stimulating hormone, adrenocorticotrope hormone, growth hormone and prolactin) are absent or produced at markedly reduced levels. This differentiation deficit is accompanied by upregulated expression of components of the Notch signaling pathway, and by prolonged expression of progenitor markers, such as Sox2. Furthermore, skeletal muscle-specific genes are ectopically expressed in endocrine cells, indicating that Insm1 participates in the repression of an inappropriate gene expression program. Because Insm1 is also essential for differentiation of endocrine cells in the pancreas, intestine and adrenal gland, it is emerging as a transcription factor that acts in a pan-endocrine manner. The Insm1 factor contains a SNAG domain at its N-terminus, and the SNAG domain is shown in this study to recruit histone-modifying factors (Kdm1a, Hdac1/2 and Rcor1-3) and other proteins implicated in transcriptional regulation (Hmg20a/b and Gse1). Deletion of sequences encoding the SNAG domain in mice disrupts differentiation of pituitary endocrine cells, and results in an upregulated expression of components of the Notch signaling pathway and ectopic expression of skeletal muscle-specific genes. This work demonstrates that Insm1 acts in the epigenetic and transcriptional network that controls differentiation of endocrine cells in the anterior pituitary gland, and that it requires the SNAG domain to exert this function in vivo (Welcker, 2013).

In vitro analysis of huntingtin-mediated transcriptional repression reveals multiple transcription factor targets

Transcriptional dysregulation has emerged as a potentially important pathogenic mechanism in Huntington's disease, a neurodegenerative disorder associated with polyglutamine expansion in the huntingtin (htt) protein. This study reports the development of a biochemically defined in vitro transcription assay that is responsive to mutant htt. Both gene-specific activator protein Sp1 and selective components of the core transcription apparatus, including TFIID and TFIIF, are direct targets inhibited by mutant htt in a polyglutamine-dependent manner. The RAP30 subunit of TFIIF specifically interacts with mutant htt both in vitro and in vivo to interfere with formation of the RAP30-RAP74 native complex. Importantly, overexpression of RAP30 in cultured primary striatal cells protects neurons from mutant htt-induced cellular toxicity and alleviates the transcriptional inhibition of the dopamine D2 receptor gene by mutant htt. These results suggest a mutant htt-directed repression mechanism involving multiple specific components of the basal transcription apparatus (Zhai, 2005).

This study developed an in vitro transcription assay to dissect the potential molecular mechanisms employed by mutant htt to repress transcription of specific promoters (e.g., Sp1-dependent). Taking advantage of this well-defined in vitro transcription system, it was demonstrate that specific components (TFIID and TFIIF) of the transcriptional machinery are directly targeted by mutant htt. Importantly, these in vitro results correlate very well with the in vivo effects of mutant htt, such as the previously reported disruption of Sp1 and TAF4 interaction by mutant htt at the D2 promoter (versus NR1 promoter) in primary neurons. Bearing this principle in mind, it may be possible, in the future, to take advantage of this in vitro system to identify other potential direct targets and mechanisms of transcriptional dysregulation associated with other transcription pathways in HD. Secondly, this study demonstrates that soluble rather than aggregated forms of mutant htt may directly dysregulate transcription by interfering with specific components of the transcriptional preinitiation complex. The data suggest that transcriptional dysfunction may occur as a result of interference by the soluble forms of mutant htt early in disease before any aggregation is seen. In addition, this work suggests that mutant htt may act as a special class of transcriptional repressor or corepressor. This is a potentially important point because it suggests that one of the primary and direct effects of mutant htt on transcription is via specific repressor mechanisms, whereas other documented effects of htt such as activation of transcription may be compensatory or secondary. Finally, this work demonstrates that transcriptional repression by mutant htt is polyQ length dependent. This strongly confirms the observed toxic gain of function for mutant htt. Progressive expansion of polyQ in mutant htt appears to lead to more severe repression while little or no repression is seen with wt htt both in vitro and in vivo. The strong correlation between polyQ length and the efficiency of repression observed in vitro fits well with the documented timing and severity of HD onset. This striking finding further suggests that direct disruption of transcription integrity via aberrant interactions between mutant htt, Sp1, TFIID, and TFIIF are specific and may be significant for orchestrating the pathogenesis of HD (Zhai, 2005).

In this work, a variety of different htt N-terminal fragment constructs were used to take advantage of the various systems established by other HD researchers. Although truncated htt proteins might behave somewhat different from the intact protein, it is nevertheless believed that these in vitro and in vivo studies should be quite informative. Indeed, in vitro studies were inspired by previous findings showing that various truncated versions of mutant htt bearing different lengths of polyQ expansions are produced by proteolytic cleavage in vivo, resulting in fragments that can readily enter the nucleus. Thus, these in vitro studies largely attempt to recapitulate the situation that is thought to occur in vivo (Zhai, 2005).

The most striking finding from the in vitro studies was the identification of TFIIF as a novel direct target in mutant htt-mediated transcriptional repression. Although there have been reports linking TFIIF to the function of transcription activators and repressors, this study provides the first direct connection between TFIIF and transcriptional repression induced by a polyQ expansion protein. RAP30, a subunit of TFIIF, appears to consist of three functional domains. The N-terminal domain of RAP30 is thought to bind RAP74, the central region binds RNA Pol II, and the C-terminal domain binds DNA. In this study, it was found that mutant htt has a strong affinity for RAP30. Because RAP30 lacks a Q-rich domain, its interaction with mutant htt is likely mediated through an alternative interface. Crystal structure of the N-terminal fragments of RAP30 and RAP74 have been shown to adopt a triple-barrel structure with multiple β sheets. Since mutant htt favors the formation of an intramolecular β sheet structure, it is possible that the RAP30 mutant htt interaction involves contact between β sheet structures. Such a structure-based interference mechanism is consistent with the finding that expansion of glutamines in mutant htt enhanced its affinity for RAP30. Thus, mutant htt may target not only polyQ-containing proteins, but also non-polyQ proteins with specific β sheet structures. It should be noted that addition of Congo red, a β sheet-reactive reagent, to the in vitro system did not prevent mutant htt-mediated transcriptional repression, possibly due to its inability to prevent mutant htt from forming protofibrils in vitro (Zhai, 2005).

An important aspect revealed by this study is that mutant htt has a higher affinity for RAP30 than wt htt and may compete with RAP74 for interaction with RAP30. Because an intact TFIIF complex is required for efficient initiation and elongation of transcription at least for some promoters, it is hypothesized that TFIIF dissociation will contribute to transcriptional dysregulation by mutant htt. It is conceivable that mutant htt, which has a higher affinity for RAP30, when it accumulates in both the cytoplasm and nucleus could cause less TFIIF to be formed in the cytoplasm and more TFIIF to be disrupted in the nucleus. Such a scenario will likely result in a general decrease of transcription in HD cells, as has been observed. In several DNA microarray studies, the level of RNA Pol II large subunit has been shown to increase in mutant HD brain. Since the role of TFIIF in transcription is dependent on its interaction with RNA Pol II, it is speculate that elevated levels of RNA Pol II subunits in HD cells may arise as a compensatory mechanism triggered by decreased levels of TFIIF. However, in vitro, adding excess RNA Pol II did not rescue the htt-mediated repression (Zhai, 2005).

By contrast, the findings showed that overexpression of RAP30 is able to abrogate transcriptional repression and rescue the cellular toxicity induced by mutant htt in primary striatal neurons. There are two potential explanations. One possibility is for RAP30 to interact with mutant htt and compete it away from other htt-interacting partners. Another possibility is for RAP30 to drive the formation of more TFIIF complexes, thereby potentiating transcription of important genes involved in neuronal survival. An intriguing observation that was made is that overexpression of RAP74 alone can induce significant cellular toxicity in striatal neurons. This suggests that the chronic release of free RAP74 from TFIIF may contribute to the progressive nature of HD pathogenesis. Thus, the data favor the mechanism in which RAP30 can protect the striatal neurons by promoting TFIIF complex formation. To better understand how much the TFIIF-mediated mechanism contributes to the selective neuronal death during HD pathogenesis, it will be important to identify those genes whose transcription in striatal neurons is particularly sensitive to both mutant htt and RAP74 in future investigations (Zhai, 2005).

Taking the in vitro and in vivo observations together with previous studies, the following model is proposed for how mutant htt represses Sp1-dependent gene expression in neurons. In normal cells, Sp1 is recruited to GC-box-containing promoters through its DNA binding domain. Once bound to DNA, Sp1 utilizes its multiple glutamine-rich activation domains to target components of the basal transcription machinery, one of which is TAF4, a subunit of TFIID. In a multistep recruiting process involving TFIIA, TFIID, TFIIB, TFIIE, TFIIF, TFIIH, RNA Pol II, and CRSP, the preinitiation complex is then formed on activated promoters to potentiate transcription. In HD cells, soluble nuclear mutant htt fragment is free to bind Sp1 through direct protein interactions, thus sequestering this key transcriptional activator from binding to its cognate GC boxes. Furthermore, mutant htt can also prevent Sp1-mediated recruitment of TFIID through its interaction with TAF4. In the case where there is already an Sp1-TFIID complex formed at the promoter, mutant htt could subsequently disrupt the stepwise PIC assembly by targeting TFIIF, an essential transcription factor important for initiation, promoter escape, and elongation at certain promoters. It is anticipated that for different potential target genes, mutant htt will have differential effects because these multiple transcription factor targets may be differentially required for critical functions and rate-limiting transactions at specific gene promoters. In summary, this simple model describes one potential mechanism by which mutant htt can selectively target an activator (Sp1) and multiple components of the core machinery (TFIID and TFIIF) to interfere with various stages of the transcription process. It is anticipated that this model will undergo further refinements as more gene regulatory targets for mutant htt are identified and their molecular consequences determined (Zhai, 2005).

IA1 is NGN3-dependent and essential for differentiation of the endocrine pancreas

Neurogenin 3 (Ngn3) is key for endocrine cell specification in the embryonic pancreas and induction of a neuroendocrine cell differentiation program by misexpression in adult pancreatic duct cells. The gene encoding IA1, a zinc-finger transcription factor, as a direct target of Ngn3 and it forms a novel branch in the Ngn3-dependent endocrinogenic transcription factor network. During embryonic development of the pancreas, IA1 and Ngn3 exhibit nearly identical spatio-temporal expression patterns. However, embryos lacking Ngn3 fail to express IA1 in the pancreas. Upon ectopic expression in adult pancreatic duct cells Ngn3 binds to chromatin in the IA1 promoter region and activates transcription. Consistent with this direct effect, IA1 expression is normal in embryos mutant for NeuroD1, Arx, Pax4 and Pax6, regulators operating downstream of Ngn3. IA1 is an effector of Ngn3 function as inhibition of IA1 expression in embryonic pancreas decreases the formation of insulin- and glucagon-positive cells by 40%, while its ectopic expression amplifies neuroendocrine cell differentiation by Ngn3 in adult duct cells. IA1 is therefore a novel Ngn3-regulated factor required for normal differentiation of pancreatic endocrine cells (Mellitzer, 2006).

Insm1 promotes endocrine cell differentiation by modulating the expression of a network of genes that includes Neurog3 and Ripply3

Insulinoma associated 1 (Insm1) plays an important role in regulating the development of cells in the central and peripheral nervous systems, olfactory epithelium and endocrine pancreas. To better define the role of Insm1 in pancreatic endocrine cell development mice were gnerated with an Insm1(GFPCre) reporter allele and were used to study Insm1-expressing and null populations. Endocrine progenitor cells lacking Insm1 were less differentiated and exhibited broad defects in hormone production, cell proliferation and cell migration. Embryos lacking Insm1 contained greater amounts of a non-coding Neurog3 mRNA splice variant and had fewer Neurog3/Insm1 co-expressing progenitor cells, suggesting that Insm1 positively regulates Neurog3. Moreover, endocrine progenitor cells that express either high or low levels of Pdx1, and thus may be biased towards the formation of specific cell lineages, exhibited cell type-specific differences in the genes regulated by Insm1. Analysis of the function of Ripply3, an Insm1-regulated gene enriched in the Pdx1-high cell population, revealed that it negatively regulates the proliferation of early endocrine cells. Taken together, these findings indicate that in developing pancreatic endocrine cells Insm1 promotes the transition from a ductal progenitor to a committed endocrine cell by repressing a progenitor cell program and activating genes essential for RNA splicing, cell migration, controlled cellular proliferation, vasculogenesis, extracellular matrix and hormone secretion (Osipovich, 2014).

Insm1 (IA-1) is an essential component of the regulatory network that specifies monoaminergic neuronal phenotypes in the vertebrate hindbrain

Monoaminergic neurons include the physiologically important central serotonergic and noradrenergic subtypes. This study identified the zinc-finger transcription factor, Insm1, as a crucial mediator of the differentiation of both subtypes, and in particular the acquisition of their neurotransmitter phenotype. Insm1 is expressed in hindbrain progenitors of monoaminergic neurons as they exit the cell cycle, in a pattern that partially overlaps with the expression of the proneural factor Ascl1. Consistent with this, a conserved cis-regulatory sequence associated with Insm1 is bound by Ascl1 in the hindbrain, and Ascl1 is essential for the expression of Insm1 in the ventral hindbrain. In Insm1-null mutant mice, the expression of the serotonergic fate determinants Pet1, Lmx1b and Gata2 is markedly downregulated. Nevertheless, serotonergic precursors begin to differentiate in Insm1 mutants, but fail to produce serotonin because of a failure to activate expression of tryptophan hydroxylase 2 (Tph2), the key enzyme of serotonin biosynthesis. Both Insm1 and Ascl1 coordinately specify Tph2 expression. In brainstem noradrenergic centres of Insm1 mutants, expression of tyrosine hydroxylase is delayed in the locus coeruleus and is markedly deficient in the medullary noradrenergic nuclei. However, Insm1 is dispensable for the expression of a second key noradrenergic biosynthetic enzyme, dopamine beta-hydroxylase, which is instead regulated by Ascl1. Thus, Insm1 regulates the synthesis of distinct monoaminergic neurotransmitters by acting combinatorially with, or independently of, Ascl1 in specific monoaminergic populations (Jacob, 2009).

REFERENCES

Search PubMed for articles about Drosophila nervous fingers 1

Breslin, M. B., Zhu, M., Notkins, A. L. and Lan, M. S. (2002). Neuroendocrine differentiation factor, IA-1, is a transcriptional repressor and contains a specific DNA-binding domain: identification of consensus IA-1 binding sequence. Nucleic Acids Res. 30(4): 1038-45. 11842116

Breslin, M. B., Zhu, M. and Lan, M. S. (2003). NeuroD1/E47 regulates the E-box element of a novel zinc finger transcription factor, IA-1, in developing nervous system. J. Biol. Chem. 278(40): 38991-7. 12890672

Brody, T., Stivers, C., Nagle, J. and Odenwald, W. F. (2002a). Identification of novel Drosophila neural precursor genes using a differential embryonic head cDNA screen. Mech. Dev. 113(1): 41-59. 11900973

Brody, T. and Odenwald, W. F. (2002b). Cellular diversity in the developing nervous system: a temporal view from Drosophila, Development 129: 3763-3770. 12135915

Brody, T., Rasband, W., Baler, K., Kuzin, A., Kundu, M. and Odenwald, W. F. (2008). Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers. BMC Genomics 9: 371. PubMed Citation: 18673565

Cayirlioglu, P., et al. (2008). Hybrid neurons in a microRNA mutant are putative evolutionary intermediates in insect CO2 sensory systems. Science 319(5867): 1256-60. PubMed citation: 18309086

Desai, C. (1988). A genetic pathway for the development of the Caenorhabditis elegans HSN motor neurons, Nature 336: 638-646. 3200316

Desai, C. and Horvitz, H. R. (1989). Caenorhabditis elegans mutants defective in the functioning of the motor neurons responsible for egg laying. Genetics 121: 703-721. 2721931

Enright, A. J., et al. (2003). MicroRNA targets in Drosophila, Genome Biol. 5: R1. 14709173

Feng, G., Yi, P., Yang, Y., Chai, Y., Tian, D., Zhu, Z., Liu, J., Zhou, F., Cheng, Z., Wang, X., Li, W. and Ou, G. (2013). Developmental stage-dependent transcriptional regulatory pathways control neuroblast lineage progression. Development. PubMed ID: 23946438

Froldi, F., Szuperak, M., Weng, C. F., Shi, W., Papenfuss, A. T. and Cheng, L. Y. (2015). The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells. Genes Dev 29(2): 129-143. PubMed ID: 25593306

Fujioka, M., et al. (2003). Even-skipped, acting as a repressor, regulates axonal projections in Drosophila, Development 130: 5385-5400. 13129849

Goto, Y., et al. (1992). A novel human insulinoma-associated cDNA, IA-1, encodes a protein with "zinc-finger" DNA-binding motifs. J. Biol. Chem. 267(21): 15252-7. 1634555

Hartl, M., et al. (2011). A new Prospero and microRNA-279 pathway restricts CO₂ receptor neuron formation. J. Neurosci. 31(44): 15660-73. PubMed Citation: 22049409

Jacob, J., et a. (2009). Insm1 (IA-1) is an essential component of the regulatory network that specifies monoaminergic neuronal phenotypes in the vertebrate hindbrain. Development 136(14): 2477-85. PubMed Citation: 19542360

Kuzin, A., Brody, T., Moore, A. W. and Odenwald, W. F. (2005). Nerfin-1 is required for early axon guidance decisions in the developing Drosophila CNS. Dev. Biol. 277: 347-365. 15617679

Kuzin, A., Kundu, M., Brody, T. and Odenwald, W. F. (2007). The Drosophila nerfin-1 mRNA requires multiple microRNAs to regulate its spatial and temporal translation dynamics in the developing nervous system. Dev. Biol. 310(1): 35-43. PubMed citation; Online text

Kuzin, A., Kundu, M., Ekatomatis, A., Brody, T. and Odenwald, W. F. (2009). Conserved sequence block clustering and flanking inter-cluster flexibility delineate enhancers that regulate nerfin-1 expression during Drosophila CNS development. Gene Expr. Patterns 9(2): 65-72. PubMed Citation: 19056518

Lan, M. S., Li, Q., Lu, J., Modi, W. S. and Notkins, A. L. (1994). Genomic organization, 5'-upstream sequence, and chromosomal localization of an insulinoma-associated intronless gene, IA-1. J. Biol. Chem. 269(19): 14170-4. 8188699

Mellitzer, G., et al. (2006). IA1 is NGN3-dependent and essential for differentiation of the endocrine pancreas. EMBO J. 25(6): 1344-52. 16511571

Mitani, S., Du, H., Hall, D. H., Driscoll, M. and Chalfie, M. (1993). Combinatorial control of touch receptor neuron expression in Caenorhabditis elegans. Development 119(3): 773-83. 8187641

Odenwald WF, Rasband W, Kuzin A, Brody T. EVOPRINTER, a multigenomic comparative tool for rapid identification of functionally important DNA. Proc. Natl. Acad. Sci. 102: 14700-5. PubMed citation: 16203978

Osipovich, A. B., Long, Q., Manduchi, E., Gangula, R., Hipkens, S. B., Schneider, J., Okubo, T., Stoeckert, C. J., Jr., Takada, S. and Magnuson, M. A. (2014). Insm1 promotes endocrine cell differentiation by modulating the expression of a network of genes that includes Neurog3 and Ripply3. Development 141: 2939-2949. PubMed ID: 25053427

Parrish, J. Z., Kim, M. D., Jan, L. Y. and Jan, Y. N. (2006). Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites. Genes Dev. 20(7): 820-35. Medline abstract: 16547170

Rong, Y. S. and Golic, K. G. (2001). A targeted gene knockout in Drosophila, Genetics 157: 1307-1312. 11238415

Stivers, S., Brody, T., Kuzin, A. and Odenwald, W. F. (2000). Nerfin-1 and -2, novel Drosophila Zn-finger transcription factor genes expressed in the developing nervous system, Mech. Dev. 97: 205-210. 11025227

Vissers, J. H. A., Froldi, F., Schroder, J., Papenfuss, A. T., Cheng, L. Y. and Harvey, K. F. (2018). The Scalloped and Nerfin-1 transcription factors cooperate to maintain neuronal cell fate. Cell Rep 25(6): 1561-1576. PubMed ID: 30404010

Welcker, J. E., Hernandez-Miranda, L. R., Paul, F. E., Jia, S., Ivanov, A., Selbach, M. and Birchmeier, C. (2013). Insm1 controls development of pituitary endocrine cells and requires a SNAG domain for function and for recruitment of histone-modifying factors. Development 140: 4947-4958. PubMed ID: 24227653

Wu, J., Duggan, A. and Chalfie, M. (2001). Inhibition of touch cell fate by egl-44 and egl-46 in C. elegans. Genes Dev. 15: 789-802. 11274062

Xie, J., Cai, T., Zhang, H., Lan, M. S. and Notkins, A. L. (2002). The zinc-finger transcription factor INSM1 is expressed during embryo development and interacts with the Cbl-associated protein. Genomics 80(1): 54-61. 12079283

Xu, J., Hao, X., Yin, M. X., Lu, Y., Jin, Y., Xu, J., Ge, L., Wu, W., Ho, M., Yang, Y., Zhao, Y. and Zhang, L. (2017). Function of Nerfin-1 in preventing medulla neurons dedifferentiation requires its inhibition of Notch activity. Development 144(8):1510-1517w. PubMed ID: 28242614

Yu, H., Pretot, R. F., Burglin, T. R. and Sternberg, P. W. (2003). Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior. Development 130(21): 5217-27. 12954713

Zhai, W., Jeong, H., Cui, L., Krainc, D. and Tjian, R. (2005). In vitro analysis of huntingtin-mediated transcriptional repression reveals multiple transcription factor targets. Cell 123(7): 1241-53. 16377565

Zhu, M., Breslin, M. B. and Lan, M. S. (2002). Expression of a novel zinc-finger cDNA, IA-1, is associated with rat AR42J cells differentiation into insulin-positive cells. Pancreas 24(2): 139-45. 11854618

Zhu, H., Zhao, S. D., Ray, A., Zhang, Y. and Li, X. (2022). A comprehensive temporal patterning gene network in Drosophila medulla neuroblasts revealed by single-cell RNA sequencing. Nat Commun 13(1): 1247. PubMed ID: 35273186

date revised: 23 August 2017

Home page: The Interactive Fly © 2017 Thomas Brody, Ph.D.